File:Jr rmf 1.jpg
From 2008.igem.org
Size of this preview: 800 × 351 pixels
Full resolution (960 × 421 pixels, file size: 105 KB, MIME type: image/jpeg)
‘’’A’’’ 1.5% agarose gel with marker 100bp DNA ladder plus (Fermentas); pSB1A7: vector pSB1A7 digested with XbaI and SpeI according to [NEB] manual; RMF: PCR product of RMF amplified from DH5-alpha genomic DNA using forward primer 5'-cgcggaattcgcggccgcttctagatgaagagacaaaaacgagatcgcctgg and reverse primer 5'-cgcgctgcagcggccgctactagtattattaggccattactaccctgtccgc; reaction setup was 35ul water, 10ul [Finnzyme] Phusion HF buffer, 1ul 10mM dNTPs, 1ul 25uM forward primer, 1ul 25uM reverse primer, 0.5ul DH5-alpha genomic DNA, 0.5ul [Finnzyme] Phusion Hot-start polymerase; thermocycler program was 98C for 3min, cycle start: 98C for 10s, 55C for 30s, 72C for 10s, cycle end, 35 repeats, 72C for 30min, 4C hold; the PCR product was restriction digested with XbaI and SpeI and purified using Qiagen Qiaquick PCR purification kit; ligation: ligation of XbaI/SpeI linearized pSB1A7 with RMF insert. ‘’’B’’’ 2% agarose gel of test digests (XbaI/SpeI; according to [NEB] manual) of pSB1A7-RMF. Six colonies were used for overnight cultures and test digested; colonies were designated R1, R2, R3, R4, R5, R6. Only R2, R4, R5 and R6 contain the insert
File history
Click on a date/time to view the file as it appeared at that time.
Date/Time | Thumbnail | Dimensions | User | Comment | |
---|---|---|---|---|---|
current | 23:40, 26 October 2008 | 960×421 (105 KB) | Jrabl (Talk | contribs) | (‘’’A’’’ 1.5% agarose gel with marker 100bp DNA ladder plus (Fermentas); pSB1A7: vector pSB1A7 digested with XbaI and SpeI according to http://www.neb.com NEB manual; RMF: PCR product of RMF amplified from DH5-alpha genomic DNA using forwar) |
File links
There are no pages that link to this file.