IGEM:Cambridge/2008/Notebook/Voltage/Gene Design

From 2008.igem.org

x

The two constructs that we designed are detailed bellow. KDP is the potassium importer and GluR0 is the glutamate gated potassium channel. Details of their construction can be found here:

KDP

GluR0


Contents

KdpF-C Biobrick- BBa_K090003=

Gene Selection

  • Kdp is a well documented P-Type K+ ATPase found naturally in E.coli, used to actively pump ions into the cell.
  • It consists of a 6-gene operon: F,A,B,C,D,E Where F-C are the functional membrane protein subunits, and D-E comprises a bacterial 2-component regulatory system.

Native operon context from NCBI

  • Literature shows that Kdp acts as a high-affinity transport system, and works most effectively at low external potassium concentrations, where a change in ion flux would be most likely to produce a measurable voltage difference.
  • The D-E 2-component system consists of a membrane protein turgidity sensor and a transcription factor. It controls Kdp operon expression in vivo, by reducing gene expression when turgor is high.
  • Since we wish to over-express Kdp, we decided not to include the regulatory system in our biobrick. (Osmotic buffering would be used instead.)

Amplification from E.coli MG1655

  • This was performed via PCR amplification of the genome template using the following primers:
         -Forward: ATAT GAATTC ATAT TCTAGA TGAGTGCAGGCGTGATAACCGGCGTATT 
                        EcoRI        XbaI
         -Reverse: CTCT CTGCAG CTCT ACTAGT TTATTCATCAAGTTTATCCAGCGCCAGAT
                        PstI         SpeI 
  • Primer overhangs incorporated the biobrick prefix and suffix into the section, restriction sites shown in bold .
  • The result of this PCR is shown below:

Image:kdp pcr prod.JPG

Integration into Vector

  • The vector used was low copy-number plasmid pSB4C5, with chloramphenicol resistance and a death gene as selection markers.
  • Kdp PCR product and pSB4C5 were both cut with EcoRI & SpeI, (vector backbone was dephosphorylated to prevent circularisation) then ligation into the vector can occur as shown.
  • . . . . . . . . . . . . . . . . . . . . . . . .
  • Note: pSB4C5_Kdp biobrick plasmid has no promoter/RBS and so Kdp is not expressed in transformants.

Promoter+RBS Biobrick

Promoter and RBS Selection

Promoter

  • The promoter chosen for use with Kdp was OsmY (Part BBa_J45992).
  • It is a stationary phase promoter, and since we require high cell densities in our final "voltage measurement" medium, we want Kdp to only be expressed in stationary phase.
  • This will reduce the metabolic and osmotic stress on dividing cells in exponential phase.

Ribosome Binding Site

  • Three different strength RBSs were investigated, B0030, B0031 and B0032.
  • B0030 is the strongest(15bp length), B0031 medium(14bp) and B0032 weakest(13bp).
  • Investigating three will help us determine the optimum levels of Kdp expression.


Amplification from E.coli MG1655

  • These parts were extracted using PCR from the Registry of Standard Biological Parts. However, the RBS biobricks are so small that we built their sequences into the reverse primers.
  • The primer sequences used are:
         -Forward: CTAT GAATTC ATAT TCTAGA GCTGGCACAGGAACGTTATCC (All OsmY-RBS constructs)
                        EcoRI        XbaI
         -B0030 Reverse: CGCG CTGCAG CTCT ACTAGT (TTTCTCCTCTTTAAT)TTGTTAAATATAGA
                               PstI        SpeI      B0030
         
         -B0031 Reverse: CTCT CTGCAG CTCT ACTAGT (GGTTTCCTGTGTGA)TTGTTAAATATAGAT
                               PstI        SpeI      B0031
         
         -B0032 Reverse: CTCT CTGCAG CTCT ACTAGT (CTTTCCTGTGTGA)TTGTTAAATATAGATCA
                               PstI        SpeI      B0032
  • PCR with these primers creates three different promoter-RBS biobrick parts (OsmY-B003x):

Integration into Vector

  • The vector used was low copy-number plasmid pSB4C5, with chloramphenicol resistance and a death gene as selection markers.
  • OsmY-B003x and pSB4C5 were both cut with XbaI & SpeI, (vector backbone was dephosphorylated to prevent circularisation) then ligation into the vector can occur as shown:
  • . . . . . . . . . . . . . . . . . . . . . .
  • Note: This promoter-RBS construct did not cause unwanted transcript problems because there are many double terminators scattered throughout the pSB4C5 backbone.

Combination of Kdp, OsmY and B003x to make BBa_K090004

  • This will create a functional biobrick plasmid in which Kdp is overexpressed only in stationary phase of growing cells.
  • Cut pSB4C5-Kdp with XbaI and PstI
  • Cut pSB4C5-OsmY-B003x with PstI first, then SpeI, in order to make sure Pst cuts correctly.
  • Ligation will form the following functional plasmid:

GluR0 Biobrick- BBa_K090002

Gene Selection

  • In order to create a measurable voltage change when a chemical was "recognised" we decided to use an ionotropic ligand-gated potassium efflux channel that binds glutamate. This also simulates the action of glutamate as a neurotransmitter in the CNS.
  • The gene chosen comes from the cyanobacteria Synechocystis sp. PCC 6803. This species is gram negative (similar to E.coli) and is used as a paradigm for evolutionary research concerning the AMPA receptor proteins.
  • GluR0 is a well characterised glutamate-gated K+ membrane channel, which has a considerable degree of structural and functional homology to rat neurone GluR2 AMPA receptors, see the paper Functional Characterisation of a Glutamate-gated Potassium Channel

DNA Synthesis

  • The protein sequence was obtained via NCBI from the Synechocystis sp. PCC 6803 genome.
  • The gene sequence could not be directly used because of codon optimisation problems (Synechocystis uses many codons that are "rare" in E.coli"
  • The protein sequence was back-translated to DNA using GeneDesignerâ„¢ and codons were assigned using the E.coli usage table.
  • The promoter BBa_J23116, RBS BBa_J61117 and Biobrick prefix and suffix sequences were added to the design.
  • Finally, unwanted restriction sites within the gene(EcoRI, XbaI, SpeI and PstI) were manually removed by selecting alternative codons for any given amino acid.
  • The gene was synthesised and sequenced by DNA2.0 into one of their standard vectors.


x