Team:Bologna/Wetlab

From 2008.igem.org

HOME PROJECT TEAM SOFTWARE MODELING WET LAB LAB-BOOK SUBMITTED PARTS BIOSAFETY AND PROTOCOLS


Contents

Introduction

To obtain regulated promoters we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins. Here is explained how we designed the operator libraries and isolated single operators to clone them in the standard format. Moreover, we built and tested: a LacI regulated promoter to tune promoter activation and a lexA based promoter to study the SOS activation (UV and peroxidase).


Up

At last... Operator sites as BioBricks!

Even though transcriptional regulation still plays a pivotal role in synthetic biology, a modular assembly of regulated promoters and the characterization of their properties has not been formalized, yet. At present state, each promoter in the Registry, though complex, is treated as a “standalone” monolithic element. Thus, the choice of a regulated promoter implies a prefixed sigmoid regulation curve. The only option, using the current BioBricks, is to choose a discretional scaling factor in the transfer of the transcription function to the protein through an appropriate RBS. Critically, the choice of one specific transcription factor limits the choice to just one possible promoter. The assembly of regulated promoters as the combination of modular parts, i. e. unregulated promoters and operators, could permit the rapid design of regulatory elements with fixed characteristics. In fact, promoter transcriptional strength and repressor binding affinity could be independently chosen.

A first step in the rationalization of promoter design was done in the iGEM 2007 with the introduction in the Registry of a family of constitutive promoters. Each family element differs from the others just for few base pairs in -35 and -10 regions, keeping constant the rest of the sequence and giving rise to a different level of transcription strength. We decided to use this valuable work as a platform for a deeper and more general promoter design strategy. To obtain regulated promoters we decided to combine these parts with short regulatory sequences that operate as a binding site for the transcription factor. To this aim, we synthesized four libraries of operator sequences, respectively for LacI, TetR, cI and LexA repressor proteins (see details). In each library, there are three sequences (see Table below) each with a different repressor binding affinity to the repressor protein. Since the libraries were synthetized on pGA18 and pMA Geneart vectors, we isolated each operator with the intention to clone them into BioBrick standard assembly plasmids. The choice of the operator should give a relative fine-tuning of promoter sensitivity to the repressor. We decided to take the Berkley's costitutive promoter library as a good "collection" from which we could select the unregulated promoter, according with the chosen transcriptional strength.


LacI
Name Sequence Affinity
Lac SymL aattgtgagcgctcacaatt Very Strong
Lac O1 aattgtgagcggataacaatt Intermediate
Lac O2 aaatgtgagcgagtaacaacc Weak
Tet
Name Sequence Affinity
TeT O cctatcagtgataga Strong
TetO-4C cctgtcagtgacaga Intermediate
TetO-wt/4C5G cctatcagtgacgga Weak










Lambda
Name Sequence Affinity
Lambda OR1 tatcaccgccagaggta Strong/Intermediate cI/Cro
Lambda OR2 taacaccgtgcgtgttg Intermediate/Weak cI/Cro
Lambda OR3 tatcaccgcaagggata Intermediate/Intermediate cI/Cro
Lex
Name Sequence Affinity
LexA 1 ctgtatatatatacag Very Strong
LexA 2 ctgtatgagcatacag Quite Weak












Single operators or a combination of them, can be also assembled upstream or downstream with respect to a constitutive promoter. In fact, it is known (Cox et al, 2007) that the position of an operator site plays a crucial role in determining repression effects (i.e. lambda operators). In particular, the same operator located upstream of the promoter -35 sequence functions as a weaker repressor than one located downstream of the -10 consensus sequence.


Up

Operator site cloning in standard plasmids

Operator sites are Dna sequences very small in length (15 to 20 bp) and a restriction digestion for the religation in standard plasmids is not possible with the existing purification kits. In fact, only Dna sequences down to at least 40 bp can be efficiently purified with the standard kits available. Small bands extraction requires laborious condition optimization and hazardous reagents like phenol-chloroform So, we decided to set a new protocol up for the isolation and cloning of single operator sites into standard BioBricks plasmids.

We started from the analysis of an existing custom vector into the Registry. In this vector, a RFP gene was cloned, as a reporter, between the SpeI and PstI restriction sites. Thus, this is the only part in the Registry that can be separated from a plasmid with a S/P digestion.

Therefore, once the RFP is isolated with S/P, it could be assembled with an operator sequence digested SpeI- PstI, too. This could allow the isolation of the Operator- RFP sequence from the commercial plasmid and the subsequent religation into a standard plasmid. Then, a final extraction of the RFP gene with a SpeI- PstI digestion would leave the operator site inside the standard plasmid.


Up

Experimental assesment of LacI operator functionality

According to the protocol to test operator parts (procedure for K-index identification), two circuits were assembled (Figure 1): K079020 is the closed-loop configuration where GFP expression is auto-regulated by the synthesis of LacI repressor protein; K079026 is the open-loop configuration lacking the operator site to determinate the maximum fluorescence due to the constitutive promoter. In the latter construct, GFP was spaced from the promoter inserting the LacI gene sequence, to account for the abortive transcriptions.


Figure 1. Upper panel: Closed-loop configuration (K079020); lower panel Open-loop configuration (K079026)
Figure 1. Upper panel: Closed-loop configuration (K079020); lower panel Open-loop configuration (K079026)


K079020 and K079026 were transformed in HL1Blue bacterial cells according to the standard protocol. One colony from each plate was picked up and let grow overnight in LB medium at 37°C. One milliliter for each of the two samples was collected by O/N cultures and spinned at 6000-8000 rpm for three minutes. The supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition. For each slide five different views were acquired. Finally, images were elaborated with the Visual Fluo Bacteria Software. Examples of fluorescence bacteria image are shown in Figure 2a-2b. The fluorescence images reveal the repression due to the presence of the Lac operator.


Figure 2a. Open-Loop configuration (K079026)
Figure 2a. Open-Loop configuration (K079026)
Figure 2b. Closed-Loop configuration (K079020)
Figure 2b. Closed-Loop configuration (K079020)


Bacterial fluorescence distribution is shown in Figure.3


Figure 3. Box Plot of bacterium fluorescence (n=683). Max and minimum values are indicated by the horizontal bars. The median and lower and upper quartiles are also indicated.
Figure 3. Box Plot of bacterium fluorescence (n=683). Max and minimum values are indicated by the horizontal bars. The median and lower and upper quartiles are also indicated.


Results of fluorescence bacteria analysis by software are reported in tab.



The open loop and closed loop circuit fluorescence ratio (h factor) is



The Ki-index corresponding to this h factor is equal to 4.43 ( see Figure 6 in Modeling 1.5). The kr-range for the bistability is from 4 to 6 (see Figure 4 in Modeling 1.4 )


Up

Uv-Sensitive Trigger

In the genetic Flip-Flop, the amount of LacI to set ON the memory is induced by an UV-sensitive trigger . Production of LacI molecules by UV induction can be tested by replacing the LacI gene with GFP in the UV trigger, so it is possible to have a relation of the strength of LacI synthesis measuring the value of fluorescence.
We realized two new constructs (K079049 and K079050) to test the UV induction. We used two different promoters (J23118 with 1429 strength and J23100 with 2547 strength). These UV test circuits are presented schematically in Figure 4-5.


Figure 4. K079050 GFP reporter protein under the control of the J23100      constitutive promoter and LexA 2 operator
Figure 4. K079050 GFP reporter protein under the control of the J23100 constitutive promoter and LexA 2 operator


Figure 5. K079049 GFP reporter protein under the control of the J23118 constitutive promoter and LexA 2 operator
Figure 5. K079049 GFP reporter protein under the control of the J23118 constitutive promoter and LexA 2 operator


To test the UV induction we used the UV illuminator.


Up

UV Induction

Plasmids with the K079049 and K079050 constructs have been transformed in DH5alfa bacteria by standard protocol and one colony from the plate was picked up and cultured overnight in 5ml LB medium broth with ampicillin. The day after the culture was diluted in 5ml LB and antibiotic in order to have OD = 0.1 and let it grown for another one hour; after that the culture was divided in five 15ml tubes (1ml of bacteria per tube).
The 1ml volume was used to have a layer of medium enough thin to perform an uniform irradiation.

Tests with difference distances from the lamp (3 and 4 cm) with different exposition times (1, 10 and 15 s) were done. Minimum distance and maximum time were fixed to avoid lethal UV dose and mutagenesis.

After induction by UV the samples were kept for 2 hours in dark by silver paper to increase the RecA and LexA response. The OD was measured and the sample transferred in a 1ml tube, spinned at 6000-8000rpm for three minutes, the supernatant was harvested and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition that were elaborated with the Visual Fluo Bacteria Software.
OD was not altered by UV irradiation but we didn't observe GFP. Probably we were not able to find the right time/distance setting. Moreover we are not sure that an uniform irradiation takes place.


Up

Hydrogen Peroxide Induction

Since we have not success with UV induction, we tested the correct functionality of K079049 and K079050 constructs by using hydrogen peroxide induction. It is well known [Assad et al. 2004] that hydrogen peroxide is an important reactive oxygen species (ROS). The reaction of hydrogen peroxide with transition metals imposes on cells an oxidative stress that can result in damage to cell components such as proteins, lipids and principally DNA. In E.coli low concentration of H2O2 (1-3mM) results in SOS gene induction [Imlay and Linn, 1987; Goerlich et alt. 1989].

The plasmid contained the LexA Operator was transformed into DH5alfa bacteria according to the standard protocol and one colony was picked up from the plate and let it grown overnight in 15ml tube with 5ml LB medium and ampicillin. Cultured colony was diluted in 5ml LB with antibiotic and 1ul H2O2 (11M) to have medium with 2.2mM concentration of H202 and 0.1 starting OD.

As control, to prove that H2O2 has effect on the K079050, one sample of the same culture was diluted in 5ml LB medium with antibiotic without H2O2. Additionally, to demonstrate that H202 induction has not interferences with the LacI regulated promoter we also tested the K079029 (Figure 6) that was grown in the LB medium with 2.2mM of H2O2.


Figure 6. K079029 GFP expression controlled by LacI repressor under the J23114 promoter
Figure 6. K079029 GFP expression controlled by LacI repressor under the J23114 promoter


Tubes were kept to the dark by using silver paper and let them growing for 2 hours at 37°C. 1 ml of bacteria sample has been collected and transferred inside 1ml tube and spinned at 6000-8000 rpm for 3 minutes. The supernatant was discard and the pellet resuspended. Slides were prepared for the fluorescence bacteria image acquisition that were elaborated with the Visual Fluo Bacteria Software.


Figure 7. K079050 with H2O2
Figure 7. K079050 with H2O2
Figure 8. K079050 without H2O2
Figure 8. K079050 without H2O2
Figure 9. K079029 with H2O2
Figure 9. K079029 with H2O2


It is possible to see that GFP is sinthetized only in the construct with Lex A operator. In addition to prove that K079050 construct can be used in the Flip-Flop circuit without interference with IPTG, we induced both K079050 and K079029 as positive control for 2 hours with 1mM of IPTG.


Figure 10. K079029 induced by IPTG
Figure 10. K079029 induced by IPTG
Figure 11. K079050 induced by IPTG
Figure 11. K079050 induced by IPTG


As expected IPTG was not able to induce the construct with Lex A operator but it induced the circuit with LacI repressed promoter. We conclude that H2O2 induction gives an uniform activity of the regulator promoter (J23100) and the level of promoter activity can be used to set ON the memory.


Up

Homemade UV Illuminator

The UV source that we use is a GW6 Sylvania, a lamp that emitt UVC at 253,7nm near the absorption's peak of DNA with an optical output power of 1,6W; to use it safely we built a box of mdf(medium density-fibreboard) that surrounds the lamp and prevent the UVc leakeage, moreover we use a diaphragm that allows passage only to part of the light, absorbing the remainder. We insert in that box two pierced brackets, that permits to choose the distance between the lamp and the sample and then in accord with the Lambert-Beer law's the exposure time. Finally we embedded this structure in a polistyrene box for its handling and greater safety (Figure 12-13).


Figure 12
Figure 12
Figure 13
Figure 13


Up

Gel matrix

Our project use UV light for its space selectivity, that gives the possibility to irradiate a target zone without interfering with the other. To do that we build a mold to make a matrix of agarose gel;this give us a square of 25mm side's with 16 cells inside where we can locate bacteria( Figure 14 ).


Figure 14
Figure 14


Once do that is easy with an optical mask, like those used in photolithography for electronics circuits, stimulate only the selected bacteria.To realize this device we use palsticard because it is very easy to shape and clean( Figure 15 ). The mold is made of two parts that will form a sandwich with the slide: one will create the shape of the gel matrix( Figure 16 ) the other is a cover that that will give the picture into gel.


Figure 15
Figure 15
Figure 16
Figure 16


The matrix is obtained through the pressure of the cover part over the mold part( Figure 17 )


Figure 17
Figure 17


and that is the result:


Figure 18
Figure 18


Up

Bibliography

  • Friedberg EC, Walker GC and Siede W (1995) DNA Repair and Mutagenesis. Academic Press, New York, 698 pp
  • Courcelle J, Khoudursky A, Peter B, Brown PO and Hanawalt PC (2001) Comparative gene expression profiles following UV exposure in wild-type and SOS-deficient Escherichia coli. Genetics 158:41-64
  • Wagner J, Cruz P, Kim SR, Yamada M, Matsui K, Fuchs RP and Nohmi T (1999) The dinB gene encodes a novel E. coli DNA polymerase, DNA pol IV, involved in mutagenesis. Mol Cell 4:281-286
  • Mustard JA and Little JW (2000) Analysis of Escherichia coli RecA interactions with LexA, lambda CI, and UmuD by site-directed mutagenesis of rec
  • Fernandez De Henestrosa AR, Ogi T, Aoyagi S, Chafin D, Hayes JJ, Ohmori H and Woodgate R (2000)
    Identification of additional genes belonging to the lexA regulon in Escherichia coli. Mol Microbiol 35:1560-1572
  • Imlay JA and Linn S (1987) Mutagenesis and stress responses induced in Escherichia coli by hydrogen peroxide. J Bateriol 169:2967-2976
  • Goerlich O, Quillardet P and Hofnung M (1989) Induction of the SOS response by hydrogen peroxide in various Escherichia coli mutants with altered protection against oxidative DNA damage. J Bacteriol 171:6141-6147
  • Imlay JA and Linn S (1987) Mutagenesis and stress responses induced in Escherichia coli by hydrogen peroxide


Up