Final design
Scheme
The first plasmid contains the efflux pump for Nickel (RcnA), which will maintain its natural regulation dependent of RcnR and additionally, it will contain a promoter regulated by the repressor of lambda phage, cI as well as a resistance as a marker of the plasmid.
The second plasmid contains everything needed for regulating RcnA dependent on an external signal (AHL). Both luxR and aiiA will be synthesised constitutively. LuxR with a strong promoter (pTetR), as we do not want the presence of LuxR to be limiting and aiiA under the control of a moderate or weak promoter (pLacZ) for it is a very efficient enzyme, and we don't want it to degrade all AHL and prevent the signal from being transmitted. And cI*, which is a version of cI tagged with an LVA tail for rapid degradation, regulated by a promoter dependent of LuxR + AHL. It will also contain a resistance as a marker.
When AHL is added, it will bind LuxR and stimulate the production of cI*, which in turn will represses the transcription of rcnA. Like cI*, the signal produced by AHL will be short-lived since aiiA will be degradating it constantly, so the system quickly returns to its initial state.
Parts
Defining bioparts we will use or where to get what is necessary.
Part: BBa_I729006
Part of Quorum sensing used by the team Chiba in iGEM2007. Both tetR and LacI + pL are constitutive promoters, but since LacI + pL is a very strong promoter, it will probably be replaced. This biopart will be responsible for the regulation by luxR and the action of the system by AHL. Instead of GFP (Subpart E0040), the BBa_C0051 part that codes for the protein cI + LVA will be inserted, which will join the regulatory region of cI (biopart BBa_R0051) in the other plasmid.
(Previous experience: none)
Part:BBa_C0051
Region coding for the repressor cI, of lambda phage, tagged with an LVA tail for rapid degradation. cI joins the regulator cI (BBa_R0051)
(Previous experience: none)
Part:BBa_R0051
Promoter regulated by cI based on the pR promoter of lambda phage. The promoter has two binding sites for the cI repressor of lambda phage (BBa_C0051). The binding of cI leads to the suppression of the transcript synthesis.
(Previous experience: it works)
The sequence of the 3 previously mentioned bioparts is in the Registry of Standard Biological Parts and according to the information provided by the registry, DNA is available.
Part: BBa_G00510
gatttctgcatagccagacttggg
This is the forward primer for C0051, 24 bp long.
Part: BBa_G00511
cactgactagcgataactttccccac
Reverse primer for C0051, 26 bp long.
Vectors
Possibilities in bioparts:
Name |
Description |
| pSB3C5 |
Low to medium copy BioBrick standard vector |
| pSB3T5 |
Low to medium copy BioBrick standard vector |
| pSB4A3 |
pSB4A3 |
| pSB4C5 |
Low copy BioBrick standard vector |
| pSB4A1 |
pSB4A1 |
| pSB4A5 |
Low copy BioBrick standard vector |
| pSB4T5 |
Low copy BioBrick standard vector |
| BBa_I739202 |
pCK01BB1 |
Primers
Build or find oligos that we could use for our constructions.
We need:
• rcnA (with its regulatory region; no promoter).
• cI* with its AHL-LuxR dependent promoter.
• LuxR with its constitutive tetR promoter.
• AiiA with its constitutive promoter (lac is proposed, it is a moderate promoter).
• Promoter dependent of cI.
In all cases, we have to check whether they already exist (in bioparts or elsewhere) and evaluate them.
|
|
Sequence |
Tm |
Deg. |
Restr. Site |
Bioparts |
(pTetR)luxR/(p.c.strong)aiiA
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
None |
|
|
|
|
|
|
|
|
|
5' GCACCCAGGCTTTACACTTT 3'
|
|
|
None |
|
|
5' TGTTATCCGCTCACAATTCCA 3'
|
|
|
|
|
|
|
5' GATTTCTGCATAGCCAGACTTGGG 3'
|
|
|
None |
|
|
5' CACTGACTAGCGATAACTTTCCCCAC 3'
|
|
|
None |
|
|
|
5' CACTATTAATCTACTGGGGGGTAG3'
|
|
|
None |
|
|
5' AGTTATCGCATTATGCCCATG 3'
|
|
|
None |
|
Promoters
Investigate more about the proposed promoters and define if they are the most optimal depending on our needs.
Promoter |
Biopart |
Constitutive? |
Strength |
Notes |
pTetR |
BBa_R0040 |
In tetracycline presence or TetR absence |
medium |
Recomended by our advisor Miguel |
pLuxR-HSL |
BBa_R0062 |
Over-regulated by LuxR-HSL (increases its expression). |
weak (constitutive)/medium (LuxR-HSL) |
luxR could bring some trouble if it becomes a part of the sistem |
pLacIQ |
BBA_I14032 |
Yes |
high |
¿Is there a biopart? It could be the promoter for luxR |
pCyc |
BBa_I766555 |
Yes |
medium |
Yeast promoter |
J23112 |
BBa_J23113 |
Yes |
1 |
|
J23103 |
BBa_J23113 |
Yes |
17 |
|
J23113 |
BBa_J23113 |
Yes |
21 |
|
J23109 |
BBa_J23113 |
Yes |
106 |
|
J23117 |
BBa_J23113 |
Yes |
162 |
|
J23114 |
BBa_J23113 |
Yes |
256 |
|
J23115 |
BBa_J23113 |
Yes |
387 |
|
J23116 |
BBa_J23113 |
Yes |
396 |
Constitutive promoters family |
J23105 |
BBa_J23113 |
Yes |
62 |
J23110 |
BBa_J23113 |
Yes |
844 |
|
J23107 |
BBa_J23113 |
Yes |
908 |
|
J23106 |
BBa_J23113 |
Yes |
1185 |
|
J23108 |
BBa_J23113 |
Yes |
1303 |
|
J23118 |
BBa_J23113 |
Yes |
1429 |
|
J23111 |
BBa_J23113 |
Yes |
1487 |
|
J23101 |
BBa_J23113 |
Yes |
1791 |
|
J23104 |
BBa_J23113 |
Yes |
1831 |
|
J23102 |
BBa_J23113 |
Yes |
2179 |
|
J23100 |
BBa_J23113 |
Yes |
2547 |
|
Facts about kinetics & other things...
Investigate more about the elements of the system to begin building an outline for the model and defining if design is theoretically feasible.
NOTES: For LuxR to bind HSL and enable the transcription of cI, HLS should be at a micromolar concentration.
Not all bioparts have been previously used, most DNA is available but there is still no record their functionality. We need to evaluate the DNA quality to ensure that there will be no problems.