"
Team:Mississippi State/Making BioBricks
From 2008.igem.org
This is the Basic Ideas Behind Making BioBricks
How It Looks
How It Works
The Gene is flanked by a BioBrick Prefix and Suffix. These contain the restriction enzyme sequences seen above, and they allow easy construction of genetic parts. The actual code for the prefix and suffix are as follows:
- Standard BioBrick Prefix
gaattcgcggccgcttctag
- Standard BioBrick Suffix
tactagtagcggccgctgcag
