Team:NYMU-Taipei/Experiments
From 2008.igem.org
| Home | Project Overview: | pH Sensor | Attachment | Time Regulation | Waste Removal | Experiments and Parts | About Us |
Contents |
Experimental Results
Experimental Results by subteam:
Parts
These are the parts that we have contributed to the Biobricks database.
pH Sensor
| Part Name | Part Type | Part Length | Subparts | Short Description (max 60 chars) | Long Description (what it is, what it does, how to use) | Design Notes | Source (where does it come from?) |
|---|---|---|---|---|---|---|---|
| BBa_K116001 | Regulatory | 274 | Basic | nhaA promoter, that can be regulated by pH and nhaR protein. | It's E.coli K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. | Finish | E.coli K12 MG1655 |
| BBa_K116002 | Reporter | 1158 |
BBa_K116002 BBa_E0240 | high pH reporter | When system encountering high pH stress, the GFP will express to indicate the high pH condition | Finish | E.coli K12 MG1655 |
Attachment
| Part Name | Part Type | Part Length | Subparts | Short Description (max 60 chars) | Long Description (what it is, what it does, how to use) | Design Notes | Source (where does it come from?) |
|---|---|---|---|---|---|---|---|
| BBa_K116101 | Coding | 903 | FimH binding domain (Pst I mutant by our design) | The pst I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part. | Finish | E. coliK. 12 MG1655 | |
| BBa_K116102 | Coding | 392 |
BBa_R0010 BBa_B0034 BBa_J36835 BBa_J36836 | IPTG induced device. Expression of membrane protein. | This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively. | BBa_J36848 |
Urea
| Part Name | Part Type | Part Length | Subparts | Short Description (max 60 chars) | Long Description (what it is, what it does, how to use) | Design Notes | Source (where does it come from?) |
|---|---|---|---|---|---|---|---|
| BBa_K116201 | Coding | 1324 | - | ureD promoter | An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter. | Proteus mirabilis, whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See J. Bacteriol. 175 (2), 465-473 (1993) | Proteus mirabilis HI4320 |
| BBa_K116202 | Coding | bp | - | ureI | An urea transpoter | The source of urea sensor is the bacteria, Proteus mirabilis, whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See J. Bacteriol. 175 (2), 465-473 (1993)
Since the genome of Proteus mirabilis is still undersequencing, we choose Helicobacter pylori as the source of urea transporter. See Nature 397 (6715), 176-180 (1999). These associated geens are also found in several plasmids in certain strains of enterobacteria. |
Helicobacter pylori J99 |
Guanidine
| Part Name | Part Type | Part Length | Subparts | Short Description (max 60 chars) | Long Description (what it is, what it does, how to use) | Design Notes | Source (where does it come from?) |
|---|---|---|---|---|---|---|---|
| BBa_K116000 | coding | 1562 bp | yaaU | predicted organic cation transporter | putative transport protein similiar to organic cation transporter 3 (OCT3)
| E coli. K-12 | |
| BBa_K116006 | coding | 237 bp (total bp) | A frontal fragment of OCT3 | split gene for a point mutation at about length 230 bp of OCT3 | Human | ||
| BBa_K116012 | composite | bp | BBa_B0032+BBa_K116000 | Ribosomal binding site+putative transport protein | No promoter driven yet | ||
| BBa_K116013 | composite | bp | BBa_R0010+BBa_B0032+BBa_K116000 | pLac promoter+ribosomal binding site+putative transport protein |
Phosphate
| Part Name | Part Type | Part Length | Subparts | Short Description (max 60 chars) | Long Description (what it is, what it does, how to use) | Design Notes | Source (where does it come from?) |
|---|---|---|---|---|---|---|---|
| BBa_K116401 | Basic, Regulatory | 506 bps | Basic | external phosphate sensing promoter | promoter of phoB in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation. | PhoB binding site is required | E.coli |
| BBa_K116402 | Basic, coding | 2067 bps | Basic | polyphosphate kinase, a synthase of Polyphosphate | gene ppk in E.coli, an synthase of Polyphosphate to store phosphate into Polyphosphate form | EcoRI site should be removed | E.coli |
| BBa_K116403 | Basic, coding | 4673 bps | Basic | high affinity phosphate transporter | It is the operon of pst phosphate transporter in E.coli. There are five genes in this operon: pstS, pstA, pstC, pstB and phoU. | pstA and pstC are overlapped | E.coli |
| BBa_K116404 | Composite, Measure/Reporter | 1,390 bps |
BBa_K116401 BBa_E0240 | external phosphate sensing reporter | It will express GFP when external phosphate is low. | n/a | E.coli |
Time Regulation
Cyanoxilator
| Part Name | Part Type | Part Length | Subparts | Short Description (max 60 chars) | Long Description (what it is, what it does, how to use) | Sequence/Design notes | Source (where does it come from?) | Reference |
|---|---|---|---|---|---|---|---|---|
| BBa_K116500 | Regulatory | 126 | OmpF promoter that is activated or repressesed by OmpR according to osmolarity. | Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins
act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo larity, OmpF predominates in the outer membrane, while at high osmolarity the OmpF porin is replaced by OmpC.OmpF has a larger pore and a faster ¯ow rate than OmpC. | seq pOmpF | E. coli K12 | K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002). | |
| BBa_K116501 | Coding | 750 | RpaA(regulator of phycobilisome-associated) | The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR. | seq RpaA |
Synechococcus elongatus PCC7942 | 1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep Sep, 2007). | |
| BBa_K116502 | Coding | 1164 | SasA(Synechococcus adaptive sensor A) | The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR. | seq SasA | Synechococcus elongatus PCC7942 | 1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).
2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep Sep, 2007). | |
| BBa_K116503 | Reporter | 992 | BBa_R0082 BBa_E0240 | GFP under control of pOmpC promoter.R0082+E0240 | seq R0082+E0240 | |||
| BBa_K116523 | composite | BBa_K116503 BBa_K116511 | GFP under control of RpaA activated pOmpC promoter | |||||
| BBa_K116533 | BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514 | |||||||
| BBa_K116510 | Reporter | BBa_K116500 BBa_E0240 | GFP under control of pOmpF promoter.K116500+E0240 | |||||
| BBa_K116520 | composite | BBa_K116510 BBa_K116511 | GFP under control of RpaA activated pOmpF promoter | |||||
| BBa_K116530 | Device | BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514 | ||||||
| BBa_S04148 | Intermediate | BBa_K116501 BBa_B0034 | RpaA with RBS(K116501+B0034) | |||||
| BBa_K116511 | Generator | BBa_R0040 BBa_S04148 | TetR regulated RpaA generator(R0040+B0034+K116501) | |||||
| BBa_K116512 | temporary | BBa_B0034 BBa_K116502 | SasA with RBS(B0034+K116502) | |||||
| BBa_K116522 | Generator | BBa_K116512 BBa_B0015 | SasA generator | |||||
| BBa_K1165004 | Device | BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336 | Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC | KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount) | ||||
| BBa_K116514 | Device | BBa_K116522 BBa_K116504 | ||||||
| BBa_S04149 | intermediate | R0040:B0034 | ||||||
| BBa_S04150 | intermediate | J36801:B0015 | ||||||
| BBa_S04151 | intermediate | S04149:S04150 | KaiA generator |
Reloxilator
| Part Name | Part Type | Part Length | Subparts | Short Description (max 60 chars) | Long Description (what it is, what it does, how to use) | Design Notes | Source (where does it come from?) | internal code |
|---|---|---|---|---|---|---|---|---|
| BBa_K116601 | Coding | 1935 | HtlB (ftsH) coding region from E. coli | The HtlB (ftsH) coding region from E. coli. It can be used to degrade many different proteins. | E. coli K. 12 MG1655 | (1) 1 | ||
| BBa_K116602 | Coding | 294 | CII coding region from λ phage | The CII coding region from λ phage. | λ phage | (2) 2 | ||
| BBa_K116603 | Regulatory | 48 | pRE promoter from λ phage | The pRE coding region from λ phage. It is able to be induced by CII (BBa_K116602). | λ phage | (3) 3 | ||
| BBa_K116609 | Coding | 90 | CIIICd: modified CIII coding region from λ phage | CIIICd: A modified version of the CIII coding region from λ phage.
Original CIII: ATGCAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGCCCTTCCGAATCTTTACTTGAACGAATCACCC GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAGTCCCAAAGAATGGATC AAACACTTATGGCTATCCAGACTAA The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon). | HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ et al said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. | λ phage | (4) 9 | |
| BBa_K116611 | Intermediate | 2072 | BBa_K116601 BBa_B0015 | HtlB + BBa_B0015 | HtlB + T. | (5) 1T | ||
| BBa_K116612 | Intermediate | 431 | BBa_B0032 BBa_K116602 | BBa_B0015 + CII | R + CII. | (6) R2 | ||
| BBa_K116613 | Intermediate | 69 | BBa_K116603 BBa_B0032 | CIIICd + BBa_B0015 | CIIICd + RBS. | (7) 3R | ||
| BBa_K116614 | Reporter | 932 | BBa_K116603 BBa_E0240 | pRE + BBa_E0240 | The reporter for pRE. | (8) 3R4T | ||
| BBa_K116615 | Intermediate | 755 | BBa_C0061 BBa_B0015 | LuxI + BBa_E0240 | LuxI + T. | (9) 5T | ||
| BBa_K116616 | Intermediate | 775 | BBa_B0032 BBa_C0062 | BBa_R0032 + LuxR | RBS + LuxR. | (10) R6 | ||
| BBa_K116617 | Reporter | 939 | BBa_R0062 BBa_E0240 | pLux + BBa_E0240 | The reporter for pLux. | 7R4T | ||
| BBa_K116618 | Reporter | 1084 | BBa_R0010 BBa_E0240 | pLac + BBa_E0240 | The reporter for pLac. | 8R4T | ||
| BBa_K116619 | Intermediate | 227 | BBa_K116609 BBa_B0015 | CIIICd + BBa_B0015 | CIIICd + T. | 9T | ||
| BBa_K116622 | Generator | 450 | BBa_B0032 BBa_K116612 | BBa_B0032 + CII + BBa_B0015 | RBS + CII + T. | R2T | ||
| BBa_K116625 | Generator | 774 | BBa_B0032 BBa_K116615 | BBa_B0032 + LuxI + BBa_B0015 | RBS + LuxI + T. | R5T | ||
| BBa_K116626 | Generator | 912 | BBa_K116616 BBa_B0015 | BBa_B0032 + LuxR + BBa_B0015 | RBS + LuxR + T. | R6T | ||
| BBa_K116629 | Generator | 246 | BBa_B0032 BBa_K116619 | BBa_B0032 + CIIICd + BBa_B0015 | RBS + CIIICd + T. | R9T | ||
| BBa_K116631 | Generator | 2147 | BBa_K116613 BBa_K116611 | pRE + RBS + HtlB + T | HtlB regulated by the pRE promoter. | 3R1T | ||
| BBa_K116632 | Generator | 506 | BBa_K116603 BBa_K116622 | pRE + RBS + CII + T | CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. | 3R2T | ||
| BBa_K116633 | Generator | 658 | BBa_R0010 BBa_K116622 | pLac + RBS + CII + T | CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. | 8R2T | ||
| BBa_K116634 | Intermediate | 1557 | BBa_K116616 BBa_K116625 | RBS + LuxR + RBS + LuxI + T | R6R5T | |||
| BBa_K116635 | Generator | 830 | BBa_K116603 BBa_K116625 | pRE + RBS + LuxI + T | LuxI regulated by the pRE promoter. | 3R5T | ||
| BBa_K116636 | Generator | 968 | BBa_K116603 BBa_K116626 | pRE + RBS + LuxR + T | LuxR regulated by the pRE promoter. | 3R6T | ||
| BBa_K116637 | Generator | 513 | BBa_R0062 BBa_K116622 | pLux + RBS + CII + T | CII regulated by the pLux promoter. | 7R2T | ||
| BBa_K116638 | Generator | 982 | BBa_R0010 BBa_K116625 | pLac + RBS + LuxI + T | LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. | 8R5T | ||
| BBa_K116639 | Device | 454 | BBa_R0010 BBa_K116629 | Tuner: pLac + RBS + CIIICd + T | CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. | 8R9T | ||
| BBa_K116640 | Generator | 974 | BBa_R0040 BBa_K116626 | pTet + RBS + LuxR + T | LuxR regulated by the pTet promoter. Used to constitutively express LuxR. | aR6T | ||
| BBa_K116641 | Device | 2661 | BBa_K116631 BBa_K116632 | Oscillator | The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. | Should be a lot of notes here i'll put up later. | 3R1T 3R2T | |
| BBa_K116643 | Composite | 1598 | BBa_K116633 BBa_K116614 | pRE tester | Tests the pRE promoter to check if it's working. | 8R2T 3R4T | ||
| BBa_K116645 | Devices | 1620 | BBa_K116634 BBa_R0062 | Portable Synchronizer | A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. | R6R5T7 | ||
| BBa_K116646 | Intermediate | 1487 | BBa_K116640 BBa_K116637 | aR6T 7R2T | ||||
| BBa_K116648 | Intermediate | 1956 | BBa_K116640 BBa_K116638 | aR6T 8R5T | ||||
| BBa_K116651 | Composite | 3593 | BBa_K116641 BBa_K116614 | Oscillator + Reporter | Oscillator + Report to test in repoting Assay. | 3R1T 3R2T 3R4T | ||
| BBa_K116655 | Composite | BBa_K116603 BBa_K116645 | pRE + Portable Synchronizer | pRE + Portable Synchronizer | 3R6R5T7 | |||
| BBa_K116656 | Composite | 2226 | BBa_K116635 BBa_K116646 | Synchronizer | The full blown Synchronizer | 3R5T aR6T 7R2T | ||
| BBa_K116658 | Composite | 2895 | BBa_K116648 BBa_K116617 | pLux Tester | A part to test the pLux promoter | aR6T8R5T 7R4T | ||
| BBa_K116659 | Composite | 3115 | BBa_K116641 BBa_K116639 | Oscillator + Tuner | Oscillator + Tuner. A tunable oscillator. | 3R1T 3R2T 8R9T | ||
| BBa_K116665 | Composite | 2134 | BBa_K116655 BBa_K116622 | Short Synchronizer | The short synchronizer that uses the portable synchronizer | 3R6R5T7R2T | ||
| BBa_K116669 | Composite | 4084 | BBa_K116659 BBa_K116614 | Oscillator + Tuner + Reporter | 3R1T 3R2T 8R9T 3R4T | |||
| BBa_K116675 | Composite | 6226 | BBa_K116665 BBa_K116669 | Short Synchronizer + Oscillator + Tuner + Reporter | 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T | |||
| BBa_K116676 | Composite | 6226 | BBa_K116656 BBa_K116669 | Synchronizer + Oscillator + Tuner + Reporter | 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T |
"


