Team:NYMU-Taipei/Experiments

From 2008.igem.org

Image:NYMU_Banner-wider_965px.png


Contents

Experimental Results

Experimental Results by subteam:

Parts

These are the parts that we have contributed to the Biobricks database.

pH Sensor

Part Name Part Type Part Length Subparts Short Description (max 60 chars) Long Description (what it is, what it does, how to use) Design Notes Source (where does it come from?)
BBa_K116001 Regulatory 274 Basic nhaA promoter, that can be regulated by pH and nhaR protein. It's E.coli K12 sodium/proton anti-transport promoter. It can be a pH sensor. We test pH senses in different pH value and Sodium concentration. Finish E.coli K12 MG1655
BBa_K116002 Reporter 1158

BBa_K116002 BBa_E0240

high pH reporter When system encountering high pH stress, the GFP will express to indicate the high pH condition Finish E.coli K12 MG1655

Attachment

Part Name Part Type Part Length Subparts Short Description (max 60 chars) Long Description (what it is, what it does, how to use) Design Notes Source (where does it come from?)
BBa_K116101 Coding 903 FimH binding domain (Pst I mutant by our design) The pst I enzyme site at 854bp - 859bp was mutated (CTGCAG->CaGCtG). This mutated construct is convenient for us to clone in standard biobrick part. Finish E. coliK. 12 MG1655
BBa_K116102 Coding 392

BBa_R0010 BBa_B0034 BBa_J36835 BBa_J36836

IPTG induced device. Expression of membrane protein. This construct contains lac promoter (R0010), ribosome binding site (BBa_B0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively. BBa_J36848

Urea

Part Name Part Type Part Length Subparts Short Description (max 60 chars) Long Description (what it is, what it does, how to use) Design Notes Source (where does it come from?)
BBa_K116201 Coding 1324 - ureD promoter An urea sensor, which is able to form a complex with urea binding proteins and functions as a promoter. Proteus mirabilis, whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See J. Bacteriol. 175 (2), 465-473 (1993) Proteus mirabilis HI4320
BBa_K116202 Coding bp - ureI An urea transpoter The source of urea sensor is the bacteria, Proteus mirabilis, whose genome is still under sequencing (2008-Aug). The operon regulating urea-associated genes had been published many years ago. See J. Bacteriol. 175 (2), 465-473 (1993)

Since the genome of Proteus mirabilis is still undersequencing, we choose Helicobacter pylori as the source of urea transporter. See Nature 397 (6715), 176-180 (1999). These associated geens are also found in several plasmids in certain strains of enterobacteria.

Helicobacter pylori J99

Guanidine

Part Name Part Type Part Length Subparts Short Description (max 60 chars) Long Description (what it is, what it does, how to use) Design Notes Source (where does it come from?)
BBa_K116000 coding 1562 bp yaaU predicted organic cation transporter putative transport protein similiar to organic cation transporter 3 (OCT3)


E coli. K-12
BBa_K116006 coding 237 bp (total bp) A frontal fragment of OCT3 split gene for a point mutation at about length 230 bp of OCT3 Human
BBa_K116012 composite bp BBa_B0032+BBa_K116000 Ribosomal binding site+putative transport protein No promoter driven yet
BBa_K116013 composite bp BBa_R0010+BBa_B0032+BBa_K116000 pLac promoter+ribosomal binding site+putative transport protein

Phosphate

Part Name Part Type Part Length Subparts Short Description (max 60 chars) Long Description (what it is, what it does, how to use) Design Notes Source (where does it come from?)
BBa_K116401 Basic, Regulatory 506 bps Basic external phosphate sensing promoter promoter of phoB in E.coli, an external phosphate regulated promoter. It will be activated when system undergoes phosphate starvation. PhoB binding site is required E.coli
BBa_K116402 Basic, coding 2067 bps Basic polyphosphate kinase, a synthase of Polyphosphate gene ppk in E.coli, an synthase of Polyphosphate to store phosphate into Polyphosphate form EcoRI site should be removed E.coli
BBa_K116403 Basic, coding 4673 bps Basic high affinity phosphate transporter It is the operon of pst phosphate transporter in E.coli. There are five genes in this operon: pstS, pstA, pstC, pstB and phoU. pstA and pstC are overlapped E.coli
BBa_K116404 Composite, Measure/Reporter 1,390 bps

BBa_K116401 BBa_E0240

external phosphate sensing reporter It will express GFP when external phosphate is low. n/a E.coli

Time Regulation

Cyanoxilator

Part Name Part Type Part Length Subparts Short Description (max 60 chars) Long Description (what it is, what it does, how to use) Sequence/Design notes Source (where does it come from?)Reference
BBa_K116500 Regulatory 126 OmpF promoter that is activated or repressesed by OmpR according to osmolarity. Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins

act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo larity, OmpF predominates in the outer membrane, while at high osmolarity the OmpF porin is replaced by OmpC.OmpF has a larger pore and a faster ¯ow rate than OmpC.

seq pOmpF E. coli K12 K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002).
BBa_K116501 Coding 750 RpaA(regulator of phycobilisome-associated) The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR. seq RpaA

Synechococcus elongatus PCC7942

1. N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).

2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep Sep, 2007).

BBa_K116502 Coding 1164 SasA(Synechococcus adaptive sensor A) The SasA–RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR. seq SasA Synechococcus elongatus PCC7942 1.N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006).

2. S. R. Mackey, S. S. Golden, Trends Microbiol 15, 381 (Sep Sep, 2007).

BBa_K116503 Reporter 992 BBa_R0082 BBa_E0240 GFP under control of pOmpC promoter.R0082+E0240 seq R0082+E0240
BBa_K116523 composite BBa_K116503 BBa_K116511 GFP under control of RpaA activated pOmpC promoter
BBa_K116533 BBa_K116523 BBa_B0015 BBa_R0040 BBa_K116514
BBa_K116510 Reporter BBa_K116500 BBa_E0240 GFP under control of pOmpF promoter.K116500+E0240
BBa_K116520 composite BBa_K116510 BBa_K116511 GFP under control of RpaA activated pOmpF promoter
BBa_K116530 Device BBa_K116520 BBa_B0015 BBa_R0040 BBa_K116514
BBa_S04148 Intermediate BBa_K116501 BBa_B0034 RpaA with RBS(K116501+B0034)
BBa_K116511 Generator BBa_R0040 BBa_S04148 TetR regulated RpaA generator(R0040+B0034+K116501)
BBa_K116512 temporary BBa_B0034 BBa_K116502 SasA with RBS(B0034+K116502)
BBa_K116522 Generator BBa_K116512 BBa_B0015 SasA generator
BBa_K1165004 Device BBa_R0040 BBa_B0034 BBa_J36801 BBa_B0015 BBa_J36336 Tet+RBS+KaiA+Ter+Lac+RBS+KaiB+Lac+RBS+KaiC KaiA and KaiBC is regulated by different promoter in order to generate different amount of Kai proteins at a ratio similar to that measured in vivo KaiA:KaiB:KaiC=1:1:4 (by weight) 1:2.8:2.2 (by amount)
BBa_K116514 Device BBa_K116522 BBa_K116504
BBa_S04149 intermediate R0040:B0034
BBa_S04150 intermediate J36801:B0015
BBa_S04151 intermediate S04149:S04150 KaiA generator

Reloxilator

Part Name Part Type Part Length Subparts Short Description (max 60 chars) Long Description (what it is, what it does, how to use) Design Notes Source (where does it come from?) internal code
BBa_K116601 Coding 1935 HtlB (ftsH) coding region from E. coli The HtlB (ftsH) coding region from E. coli. It can be used to degrade many different proteins. E. coli K. 12 MG1655 (1) 1
BBa_K116602 Coding 294 CII coding region from λ phage The CII coding region from λ phage. λ phage (2) 2
BBa_K116603 Regulatory 48 pRE promoter from λ phage The pRE coding region from λ phage. It is able to be induced by CII (BBa_K116602). λ phage (3) 3
BBa_K116609 Coding 90 CIIICd: modified CIII coding region from λ phage CIIICd: A modified version of the CIII coding region from λ phage.
Original CIII:
ATGCAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGCCCTTCCGAATCTTTACTTGAACGAATCACCC
GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAGTCCCAAAGAATGGATC
AAACACTTATGGCTATCCAGACTAA

The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon).

HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since _someone_ et al said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. λ phage (4) 9
BBa_K116611 Intermediate 2072 BBa_K116601 BBa_B0015 HtlB + BBa_B0015 HtlB + T. (5) 1T
BBa_K116612 Intermediate 431 BBa_B0032 BBa_K116602 BBa_B0015 + CII R + CII. (6) R2
BBa_K116613 Intermediate 69 BBa_K116603 BBa_B0032 CIIICd + BBa_B0015 CIIICd + RBS. (7) 3R
BBa_K116614 Reporter 932 BBa_K116603 BBa_E0240 pRE + BBa_E0240 The reporter for pRE. (8) 3R4T
BBa_K116615 Intermediate 755 BBa_C0061 BBa_B0015 LuxI + BBa_E0240 LuxI + T. (9) 5T
BBa_K116616 Intermediate 775 BBa_B0032 BBa_C0062 BBa_R0032 + LuxR RBS + LuxR. (10) R6
BBa_K116617 Reporter 939 BBa_R0062 BBa_E0240 pLux + BBa_E0240 The reporter for pLux. 7R4T
BBa_K116618 Reporter 1084 BBa_R0010 BBa_E0240 pLac + BBa_E0240 The reporter for pLac. 8R4T
BBa_K116619 Intermediate 227 BBa_K116609 BBa_B0015 CIIICd + BBa_B0015 CIIICd + T. 9T
BBa_K116622 Generator 450 BBa_B0032 BBa_K116612 BBa_B0032 + CII + BBa_B0015 RBS + CII + T. R2T
BBa_K116625 Generator 774 BBa_B0032 BBa_K116615 BBa_B0032 + LuxI + BBa_B0015 RBS + LuxI + T. R5T
BBa_K116626 Generator 912 BBa_K116616 BBa_B0015 BBa_B0032 + LuxR + BBa_B0015 RBS + LuxR + T. R6T
BBa_K116629 Generator 246 BBa_B0032 BBa_K116619 BBa_B0032 + CIIICd + BBa_B0015 RBS + CIIICd + T. R9T
BBa_K116631 Generator 2147 BBa_K116613 BBa_K116611 pRE + RBS + HtlB + T HtlB regulated by the pRE promoter. 3R1T
BBa_K116632 Generator 506 BBa_K116603 BBa_K116622 pRE + RBS + CII + T CII regulated by the pRE promoter. Since pRE is regulated by CII, this is a positive feedback loop. 3R2T
BBa_K116633 Generator 658 BBa_R0010 BBa_K116622 pLac + RBS + CII + T CII regulated by the pLac promoter. Used for expressing an adjustable amount of CII. 8R2T
BBa_K116634 Intermediate 1557 BBa_K116616 BBa_K116625 RBS + LuxR + RBS + LuxI + T R6R5T
BBa_K116635 Generator 830 BBa_K116603 BBa_K116625 pRE + RBS + LuxI + T LuxI regulated by the pRE promoter. 3R5T
BBa_K116636 Generator 968 BBa_K116603 BBa_K116626 pRE + RBS + LuxR + T LuxR regulated by the pRE promoter. 3R6T
BBa_K116637 Generator 513 BBa_R0062 BBa_K116622 pLux + RBS + CII + T CII regulated by the pLux promoter. 7R2T
BBa_K116638 Generator 982 BBa_R0010 BBa_K116625 pLac + RBS + LuxI + T LuxI regulated by the pLac promoter. Used for expressing an adjustable amount of LuxI. 8R5T
BBa_K116639 Device 454 BBa_R0010 BBa_K116629 Tuner: pLac + RBS + CIIICd + T CIIICd regulated by the pLac promoter. Use for expressing an adjustable amount of CIIICd. This device is used as the "Tuner" in the Reloxilator since it binds to HtlB and can therefore repress HtlB's degradation effect on CII. 8R9T
BBa_K116640 Generator 974 BBa_R0040 BBa_K116626 pTet + RBS + LuxR + T LuxR regulated by the pTet promoter. Used to constitutively express LuxR. aR6T
BBa_K116641 Device 2661 BBa_K116631 BBa_K116632 Oscillator The relaxation oscillator (Reloxilator) containing the HtlB and CII proteins. HtlB degrades CII. CII is generated in a positive feedback loop. HtlB is waited upon to self degrade. Should be a lot of notes here i'll put up later. 3R1T 3R2T
BBa_K116643 Composite 1598 BBa_K116633 BBa_K116614 pRE tester Tests the pRE promoter to check if it's working. 8R2T 3R4T
BBa_K116645 Devices 1620 BBa_K116634 BBa_R0062 Portable Synchronizer A Between-cell synchronizer that can attach any promoter at the start and any generator at the end. R6R5T7
BBa_K116646 Intermediate 1487 BBa_K116640 BBa_K116637 aR6T 7R2T
BBa_K116648 Intermediate 1956 BBa_K116640 BBa_K116638 aR6T 8R5T
BBa_K116651 Composite 3593 BBa_K116641 BBa_K116614 Oscillator + Reporter Oscillator + Report to test in repoting Assay. 3R1T 3R2T 3R4T
BBa_K116655 Composite BBa_K116603 BBa_K116645 pRE + Portable Synchronizer pRE + Portable Synchronizer 3R6R5T7
BBa_K116656 Composite 2226 BBa_K116635 BBa_K116646 Synchronizer The full blown Synchronizer 3R5T aR6T 7R2T
BBa_K116658 Composite 2895 BBa_K116648 BBa_K116617 pLux Tester A part to test the pLux promoter aR6T8R5T 7R4T
BBa_K116659 Composite 3115 BBa_K116641 BBa_K116639 Oscillator + Tuner Oscillator + Tuner. A tunable oscillator. 3R1T 3R2T 8R9T
BBa_K116665 Composite 2134 BBa_K116655 BBa_K116622 Short Synchronizer The short synchronizer that uses the portable synchronizer 3R6R5T7R2T
BBa_K116669 Composite 4084 BBa_K116659 BBa_K116614 Oscillator + Tuner + Reporter 3R1T 3R2T 8R9T 3R4T
BBa_K116675 Composite 6226 BBa_K116665 BBa_K116669 Short Synchronizer + Oscillator + Tuner + Reporter 3R6R5T7R2T 3R1T 3R2T 8R9T 3R4T
BBa_K116676 Composite 6226 BBa_K116656 BBa_K116669 Synchronizer + Oscillator + Tuner + Reporter 3R5T aR6T 7R2T 3R1T 3R2T 8R9T 3R4T