Team:NYMU-Taipei/Project/pH Sensor

From 2008.igem.org

NYMU Banner-wider 965px.png


Contents

[edit] Motivation

  • When our system arrives in the intestine (pH is higher), it senses the pH change and starts to work.
  • In this subsystem, we are going to create a pH sensor which senses high pH's.

[edit] Goal

  • The pH sensor can sense a high pH condition and start gene expression.

[edit] Circuit Design

[edit] Regulation of nhaA gene expression

NYMU IGEM08 NhaA regulation.png NYMU NhaA protein expression and activity regulated by pH.png

[edit] Structure of nhaA gene promoter

NYMU Promoter elements of nhaA.png

  • 17,189 -17,488 in E.coli K12 genome from Ecocyc (300 bp upstream of nhaA gene)

00000000011111111112222222222344444444455555555556666666666777777777788888888889
12345678901234567890123456789012345678901234567890123456789012345678901234567890
ACGACAAGCTGGATTATTTTTGAAATATTGGCCTAACAAGCATCGCCGACTGACAACAAATTAATTATTACTTTTCCTAA
TTAATCCCTCAGGAATCCTCACCTTAAGCTATGATTATCTAGGCTTAGGGTCACTCGTGAGCGCTTACAGCCGTCAAAAA
CGCATCTCACCGCTGATGGCGCAAATTCTTCAATAGCTCGTAAAAAACGAATTATTCCTACACTATAATCTGATTTTAAC
GATGATTCGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCTGAAAGAGAAATAAAAA 
  • G is the start of NhaR binding site
  • TTTTAA is the first -35 of P1
  • ATGATT is the second -35 of P1
  • TAAAAT is the first -10 of P1
  • TAAAAA is the second -10 of P1; A in the TAAAAA is the first TSS of P1
  • AAGAGA is the S.D. (Shine-Dalgarno) sequence in RBS
  • There are 3 nhaA promoter sequences protected by NhaR from DNase I digestion
    • AATAGCTCGTAAAAAACGAATTATTCC
    • CACTATAATCTGATTTTAACGATG
    • CGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCT; T in TTCACCT is the second TSS of P1
  • The extracted DNA sequence should include the NhaR binding site
    • The NhaR binding site defined in (Nir Dover and Etana Padan et al.,2001) is 120 bp long
    • The PCR product derived from primers designed by Henry is 274 bp long

[edit] References

[edit] Experiments

[edit] NhaA promoter under 300uM sodium and pH 3.0, 7.0, 8.5

PNhaA 20081025 300uM Na 3.5h.png