"
Team:Rice University/Notebook/9 June 2008
From 2008.igem.org
Monday 9 June
- Selim Sheikh:
- Designed 2 sets of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify target regions:
- Primer Set 1:
- product of length 538
- contains region of the molecule from 20481 to 21018
- Tm = 81.7 C TaOpt: 60.4 C GC: 56.3
- area of interest = 20833
- sense primer: GAGACGAATGCCAGGTCATCTGAAA <---------------primer name: STF L
- length: 25 Tm = 60.3 C GC = 48.0
- antisense primer: AAATCTGGATCATTCCCGAGCGCTG <-----------primer name: STF R
- length: 25 Tm = 64.9 C GC = 52.0
- Primer Set 2:
- product of length 309
- contains region of the molecule from 23341 to 23649
- Tm = 70.7 C TaOpt: 51.4 C GC: 31.7
- area of interest = 23539
- sense primer: ATCACATCGTCACCCATTGGATTGT <---------------primer name: ATTP L
- length: 25 Tm = 60.1 C GC = 44.0
- antisense primer: CGATTTAGAAATGTATAGCGAGGCA <-----------primer name: ATTP R
- length: 25 Tm = 55.9 C GC = 40.0
- Primer Set 1:
- Designed 2 sets of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify target regions:
- Taylor Stevenson
- XL1-Blue MR cells were prepared for phage infection as specified in packaging manual [1] and infected with phage at roughly a 1/10 pfu/cfu ratio. Resulting phage/bacteria mixture was incubated @ 37*C for 20 min and then streaked onto an LB plate. Plate was incubated @ 30*C O/N.
- Result-approximately 100 possibly lysogenic colonies grew on plate.
| Home | The Team | The Project | Parts Submitted to the Registry | Modeling | Notebook |
|---|
