Team:Tsinghua/Project

From 2008.igem.org

(Difference between revisions)
(Reference)
(Reference)
 
(45 intermediate revisions not shown)
Line 1: Line 1:
-
{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="100%" align="center"
+
<!--- The Mission, Experiments --->
 +
[[image:331.jpeg|center|]]
 +
{| style="color:#3C7F8d;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="100%" align="center"
!align="center"|[[Team:Tsinghua|HOME]]
!align="center"|[[Team:Tsinghua|HOME]]
!align="center"|[[Team:Tsinghua/Team|Team]]
!align="center"|[[Team:Tsinghua/Team|Team]]
Line 27: Line 29:
Moreover,most of the biosensors today are designed for a specific target signal, and they can not substitute each other in most cases. By structural analysis we find that most receptors for the same type of ligands exhibit great similarity, both in sequence information and characteristics. Our project is designed for an "Interchangeable Biosensor". The strategy is almost trial and error, to find an appropriate pathway between chemical molecules and corresponding reactions. Signals other than chemicals are much harder to manipulate, and integrating all the signals seems even more challenging,we are trying to isolate the elements and standardize them.
Moreover,most of the biosensors today are designed for a specific target signal, and they can not substitute each other in most cases. By structural analysis we find that most receptors for the same type of ligands exhibit great similarity, both in sequence information and characteristics. Our project is designed for an "Interchangeable Biosensor". The strategy is almost trial and error, to find an appropriate pathway between chemical molecules and corresponding reactions. Signals other than chemicals are much harder to manipulate, and integrating all the signals seems even more challenging,we are trying to isolate the elements and standardize them.
-
[[Image:bacterium2.png]]
+
Major inspiration of our idea comes from the Three Laws of Robotics(Isaac Asimov):  
 +
1. A robot may not injure a human being, or, through inaction, allow a human being to come to harm.
 +
2. A robot must obey the orders given it by human beings except where such orders would conflict with the First Law.
-
=== Part 1 Experimental Pathway ===
+
3. A robot must protect its own existence as long as such protection does not conflict with the First or Second Law.
-
=== Part 2 The Experiments ===
 
-
'''Chemotaxis  Project'''
+
The goal is to be achieved via three different subprojects: '''CdLocalizer''', '''DualReceptor''' and '''TheoRiboSwitch'''.
-
(1)1. Reconstruct pUC18 plasmid, insert GFP to the downstream of lac promoter
+
 
 +
'''TheoRiboSwitch Project''' focuses on the verification of signals transmission between GCS and motor while '''DualReceptor Project''' focuses on the integration of multiple signals at the sensor and GCS sections. '''CdLocalizer Project''' is designed to illustrate a more complicated correlation other than linear correlation between ligand concentration and GCS.
 +
 
 +
----
 +
 
 +
'''Standardized Chemokactic Access Control and Modular Design of E.coli'''
 +
 
 +
One canonical chemotactic behavior is the response of Escherichia coli toward certain nutrition, which plays a key role in seeking food. Researchers have investigated thoroughly into the molecular mechanism of it.
 +
 
 +
Motility in prokaryotes is accomplished by flagellum, a complex structure moving the cell by rotation, much like the propeller in a motor boat. In E.coli, counterclockwise rotation moves the cell in a direction called a run, while clockwise rotation results in tumbling of the cell.
 +
 
 +
The direction of rotation is controlled by phosphorylation of CheY, a signaling protein in the chemotaxis pathway of E.coli. Low level of phosphorylation results in counterclockwise rotation of flagella and makes the cell move forward. In contrast, phosphorylated CheY favors tumbling.
 +
 
 +
The level of protein phosphorylation is regulated by certain attractant or repellent, which can bind specific receptors on the cell surface. Signals are then passed through a series of intracellular biochemical reactions, in which phosphorylation of CheY is controlled. In this way bacteria accomplish chemotactic behavior.
 +
 
 +
Molecular mechanism involve in chemotaxis behavior can be simplified into following schematics. There are several kinds of receptors for different chemotactic ligands on the membrane of E.coli. These receptors sense correspondent ligands and convert the concentration of each ligand to their activity. The total activity of them represents whether the bacterium like or hate a certain position in the environment. We name the sum of chemotactic receptors’ activity “General Chemotaxis Signal (GCS). Then the decision of chemotaxis is converted into CheY phosphorylation level, which controls rotation bias of molecular motor. Thus, concentration of CheY-p is called “Motor Control Signal (MCS)” here.
 +
 
 +
 
 +
[[Image:bacterium2.png]][[Image:block_small2.jpg]]
 +
System Block Diagram of Chemotaxis
 +
 
 +
Different types of receptors sense the concentrations of various ligands and conform them to General Chemotaxis Signal (GCS), which represents the chemotaxis decision. The rest of chemotaxis pathway is in charge of convert GCS to MCS (Motor Control Signal), which interferences motor rotation bias. The working state of motor are directly related to the positions of bacteria in medium, and coordinate of bacterium corresponds to the concentration of ligands there. Bacteria sense real-time environmental conditions and regulate its movement model through this mechanism in order to find a place with highest fitness.
 +
 
 +
----
 +
'''Status of the Three Experimental Programs in the Entire Study'''
 +
 
 +
''TheoRiboSwitch Project''
 +
 
 +
This program is mainly used to verify the design principle of signal pathway between GCS and MCS. As we have mentioned, the relation between GCS and MCS is not a simple positive correlation, but one similar to derivative relation. Their signaling pathway not only transfers the signal from some intermediates to another molecule which can interact with the motor, but also completes a similar calculation of derivation. In our study, by means of reverse engineering, we analyze the dynamic characteristics of E. coli natural chemokine pathways, and abstract the key factors which enable E.coli to guide chemokaxis. Then, on the basis of these dynamics, we modify our design for a new pathway, and verify it via computer simulation. As for the design of the final test, it must be directly linked with real E. coli, which is the final objective of this program. In the program, the concentration ligand and Ribo-switch complex corresponds to common chemokactic signals. This design does not involve the signal integration of a variety of substances, and their combination is a fast chemical balance, which minimizes the delay and makes this program a suitable verification for the second half of the entire design. 
   
   
-
1.1 Use touchdown PCR to amplify GFP and add degradation tag and terminator.
+
''DualReceptor Project''
-
Primers:
+
-
Forward: 5’- GA    GAATTC  G  AGCAAGGGCGAGGAGCTGTTCACCG -3’
+
-
                EcoR I   
+
-
Reverse: 5’- CTTG  CCCGGG  TTATCACTTGTACAGCTCGTCCATGC -3’
+
-
                Xma I
+
-
Template: provide by Guoqiang Chen’s lab in Tsinghua University
+
-
1.2 Cut pUC18 plasmid with EcoR I and KpnI. Purify the cut pUC18 from agarose gel with Kit.
+
-
1.3 Purify the PCR product GFP from agarose gel with Kit and cut with EcoR I and Kpn I.
+
-
1.4 Purify the cut GFP with column.
+
-
1.5 Run a gel to compare the concentrations of the fragment and vector in order to decide their volume in the ligation mixture.
+
-
1.6 Incubate the ligation mixture at 16 degree.
+
-
1.7 Use 10μl ligation mixture to transform 200μl DH5αcompetent cell, spread on the LB plate(Amp), and incubate at 37 degree over night.
+
-
1.8 Pick three clone to 5ml LB and shake at 37 degree for 12h, miniprep the reconstruct plasmid.
+
-
1.9 We sequenced the inserted part and it was right.
+
-
2. Synthesize the Nde I-Pm(complementary chain)-Pst I-Xba I-cad-Spe I-RBS(strong)-CI+LVA tag-Sac II-T1, T2-BamH I (the Blue part is the synthesis sequence) sequence. We use synthesis because we cannot use PCR to get the sequence from Staphyloccocus aureus Rosenbach
+
-
3. Insert CheZ(with tag and terminator) into the reconstruct pUC18(with GFP)
+
-
3.1 Extract the genome of E.coli DH5αstrain and use PCR amplify CheZ from it.
+
-
Primer:
+
-
Forward primer:
+
-
5’-GTCATGCC  CA TATG  CAACCATCAATCAAACCTGC-3’
+
-
Reverse primer:
+
-
5’-AT    AGG CCT  AAATCCAAGACTATCCAACAAATCGTCCACCTGATC-3’
+
-
3.2 Purify the PCR product from gel and then cut with Nde I
+
-
3.3 Cut the pAcYc duet-1 plasmid with EcoR V and Nde I
+
-
3.4 Run a gel to compare the concentration of the vector and insertion in order to decide the their volumes in the ligation mixture
+
-
3.5 Ligate the vector and the cheZ, transformate DH5α and spread the LB plate(Chl).
+
-
3.6 Pick three clones to 5ml LB(Chl) and shake at 37 for 12h, then miniprep the reconstruct the plasmid.
+
-
3.7 Synthesize the Stu I-tag-Hind III-T0/T1T2-AatII sequence (with stick end), which contains CheZ’s tag and terminator. We firstly synthesized the sequence as two single strings, and then annealing them together as a double string DNA.
+
-
The two single strings’ sequence is below:
+
-
Forward
+
-
5’-CCT  GCTGCAAACGACGAAAACTACGCTTTAGTAGCT  TAA      A AGCTT
+
-
Stu I end  LVA tag                              stop codon  Hind III
+
-
CGCAAAAAACCCCGCTTCGGCGGGGTTTTTTCGC  GACGT-3’
+
-
T0                                      Aat II end
+
-
Reverse
+
-
5’- C  GCGAAAAAACCCCGCCGAAGCGGGGTTTTTTGCG  A AGCTT  TTA
+
-
Aat II end      T0                                Hind III      stop codon
+
-
(complementary)
+
-
AGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC    AGG
+
-
LVA tag (complementary)                  Stu I end
+
-
3.8 Cut the pAcYcduet-1-cheZ plasmid with StuI and Aat II and column purify the vector
+
-
3.9 Run a gel to compare the concentration of the vector(pAcYcduet-1-cheZ) and insertion (Stu I-tag-Hind III-T0/T1T2-AatII) to make sure their volumes in the ligation mixture.
+
-
3.10 Ligate the two parts    transformation    spread plate    pick 4 clones    shake and get the reconstruct plasmid
+
-
3.11 We sequenced it and it was right.
+
-
3.12 Then we cut the whole CheZ-tag-terminator with NdeI and AatII and ligate the fragment into the pUC18-GFP vector, which is cut by the same two enzymes.
+
-
3.13 This sequenced this plasmid and the sequence was right.
+
-
4. Cut the synthesized Nde I-Pm(complementary chain)-Pst I-Xba I-cad-Spe I-RBS(strong)-CI+LVA tag-Sac II-T1, T2-BamH I (the Blue part is the synthesis sequence) sequence with BamH I and Nde I, the same was done on the vector(pUC18-cheZ-tag-ter-GFP). Then ligate them together and got a new reconstruct plasmid. It was also sequenced.
+
-
5. Put RBS-CI-tag into last vector.
+
-
5.1 Use PCR to amplify CI from lambda DNA, adding RBS to 5’ and tag to 3’
+
-
First round primers:
+
-
5’-GAGGGGACAAactagt  ATGAGCACAAAAAAGAAACCATTAACACAAGAGC-3’
+
-
                                            50 nt    Tm=59.8
+
-
5’-TCGTTTGCTGCAGGCCT  gccaaacgtctcttcaggccactgac-3’
+
-
                                            43 nt    Tm=63.5
+
-
Second round primers:
+
-
5’-C  A CTAGT  tctagaGAAAGAGGGGACAAactagt  ATGAGCACAAAAAAGAAACC-3’
+
-
      SpeI            RBS                      53nt      Tm=49.6,65.0
+
-
5’-ACT  CCGC GG TTA AGCTGCTAAAGCGTAGTTTTCGTCGTTTGCTGCAGGCCT  gccaaacgtctcttcagg
+
-
      Sac II      LAA tag(complementary)            69nt      Tm=53.4, >75
+
-
We also did a point mutation with PCR to mutate a Hind III restriction cite.
+
-
For:
+
-
5’-GGCTCCAAGCCTAGCTTTCCTGACGGAATG-3’
+
-
                    30 nt    Tm=65.6
+
-
Rev
+
-
5’- cattccgtcaggaaagctaggcttggagcc-3’
+
-
5.2 Cut the RBS-CI-tag and the reconstructed vector with Sac II and Spe I and ligate them together.
+
-
5.3 Transformation the final plasmid to the ΔCheZ E.coli stain.
+
 +
The main purpose of this program is to integrate the two signals. Although in practice, the two receptors correspond to the same ligand, yet the relationship between the concentration of the ligand they mediate and GCS is just the opposite. Thus, this program can be seen as the integration (or trade-off) of the two signals. The same kind of ligand molecules are used to facilitate quantitative detection, and also to achieve a certain degree of practical significance (see description below). This program is Theophylline chemokaxis-based. A key issue needs to be addressed during the convergence of integration phase and transference phase of the signal: would the delay of signal in the first part of integration impact later signal transference? This requires proof based on theoretical analysis and simulation experiments in advance. Of course, we can also choose to establish only positive correlation between GCS and MCS, which can be called “pseudochemokaxis”, to avoid interference by the progress of the Theophylline Chemokaxis Program. 
 +
 +
''CdLocalizer Project''
 +
 +
In this program, we attempt to establish a more complex function, rather than a simple positive correlation between ligand concentration and GCS. Although the ultimate application purpose of the program is the same with the Toluene Chemokaxis Program, a different design principle is used. Just like the Toluene Chemokaxis Program, this one is faced with the same signal-conversion delay problem. Still, we can use “pseudochemokaxis” to complete signal conversion of the second half of the whole process.
-
Now we have got the reconstructed bacteria!!!!!
+
== Wetlab Work ==
 +
'''[[WetLab work]]'''
-
=== Part 3 ===
+
== Simulation ==
 +
[[Chemotaxis Modeling]]
-
== Results ==
 
== Reference ==
== Reference ==
1 Assessment of heavy metal bioavailability in contaminated sediments and soils using green fluorescent protein-based bacterial biosensors. Vivian Hsiu-Chuan Liao*, Ming-Te Chien, Yuen-Yi Tseng, Kun-Lin Ou. Environmental Pollution 142 (2006) 17e23
1 Assessment of heavy metal bioavailability in contaminated sediments and soils using green fluorescent protein-based bacterial biosensors. Vivian Hsiu-Chuan Liao*, Ming-Te Chien, Yuen-Yi Tseng, Kun-Lin Ou. Environmental Pollution 142 (2006) 17e23
-
This literature helped us to introduce GFP into our project and gave us a description of heavy metal pollutants.
 
 +
''' This literature helped us to introduce GFP into our project and gave us a description of heavy metal pollutants'''.
 +
 +
2 The  C-terminal  domain  of  the  Escherichia  coli RNA  polymerase a  subunit  plays  a  role  in  the CI-dependent  activation  of  the  bacteriophage lambda pM promoter.  Barbara  Kedzierska  ,  Anna  Szambowska  ,  Anna  Herman-Antosiewicz  ,  David  J.  Lee  , Stephen  J.W.  Busby2,  Grzegorz  Wegrzyn1  and  Mark  S.  Thomas3,* Nucleic Acids Research, 2007, Vol. 35, No. 7
 +
 +
'''This literature gives out a mechanism of CI-Pm promotor interaction.'''
 +
 +
3 Guiding Bacteria with Small Molecules and RNA.Shana Topp and Justin P. Gallivan. J. AM. CHEM. SOC. 2007, 129, 6807-6811  9
 +
 +
'''This literature lent us an overall vision of how bacteria movement happens and indicated out the central role of CheZ. It also introduced riboswitch into our project.'''
 +
 +
4 Luminescent bacterial sensor for cadmium and lead.Sisko Tauriainen, Matti Karp, Wei Chang, Marko Virta.Biosensors & Bioelectronics 13 (1998) 931–938
 +
 +
'''This literature descripted sensors for cadmium and lead.'''
 +
 +
5 Online and in situ monitoring of environmental pollutants: electrochemical biosensing of cadmium.I Biran, R Babai, K Levcov, J Rishpon, EZ Ron.Environmental Microbiology, 2000
 +
 +
'''This literature gives out a sensing and detecting method for cadmium.'''
 +
 +
6 Sensitivity of OR  in Phage lambda.Audun Bakk, Ralf Metzler, and Kim Sneppen.Biophysical Journal    Volume 86    January 2004    58–66
 +
 +
'''This literature explains the operation of operons in phage lambda.'''
 +
 +
7 An Artificial Aptazyme-Based Riboswitch and its Cascading System in E. coli. Atsushi Ogawa and Mizuo Maeda. ChemBioChem 2008, 9, 206 – 209
 +
 +
'''This is an indication of riboswitch.'''
 +
 +
 +
 +
'''Other reference'''
 +
 +
Goldstein RA & Soyer OS (2008) PLoS Comput Biol 4, e1000084.
 +
 +
Emonet T & Cluzel P (2008) Proc Natl Acad Sci U S A 105, 3304-3309.
 +
 +
Emonet T, Macal CM, North MJ, Wickersham CE, & Cluzel P (2005) Bioinformatics 21, 2714-2721.
 +
 +
Korobkova E, Emonet T, Vilar JM, Shimizu TS, & Cluzel P (2004) Nature 428, 574-578.
 +
 +
Sourjik V & Berg HC (2002) Proc Natl Acad Sci U S A 99, 123-127.
 +
 +
Yi TM, Huang Y, Simon MI, & Doyle J (2000) Proc Natl Acad Sci U S A 97, 4649-4653.
 +
 +
Lauffenburger DA (2000) Proc Natl Acad Sci U S A 97, 5031-5033.
 +
 +
Liu Z & Papadopoulos KD (1996) Biotechnol Bioeng 51, 120-125.
 +
 +
Ishihara A, Segall JE, Block SM, & Berg HC (1983) J Bacteriol 155, 228-237.
 +
Cluzel P, Surette M, & Leibler S (2000) Science 287, 1652-1655.
Line 141: Line 158:
!align="center"|[[Team:Tsinghua/Doodle|Doodle Board]]
!align="center"|[[Team:Tsinghua/Doodle|Doodle Board]]
|}
|}
 +
<!--- The Mission, Experiments --->
 +
[[image:06.jpeg|center|]]

Latest revision as of 04:56, 30 October 2008

331.jpeg
HOME Team Project 1 Project 2 Parts Modelling Notebook Doodle Board

Contents

Background

Motile bacteria can respond to chemical gradients in their environment. Such directed movement in response to special chemicals is defined as chemotaxis. If organisms detect substances beneficial for surviving, positive chemotaxis occurs and cells will move in the direction of increasing concentration. In contrast, negative chemotaxis occurs when motile bacteria move away from a repellant. Both kinds of responses adjust the behaviors of organisms to the environment, thus improve their ability of surviving.

One typical chemotactic behavior is the response of Escherichia coli toward certain nutritions, which plays a key role in seeking food. Researchers have investigated thoroughly into the molecular mechanism of it.Motility in prokaryotes is accomplished by flagellum, a complex structure moving the cell by rotation, much like the propeller in a motor boat. In E.coli, counterclockwise rotation moves the cell in a direction called a run, while clockwise rotation results in tumbling of the cell.The direction of rotation is controlled by phosphorylation of CheY, a signaling protein in the chemotaxis pathway of E.coli. Low level of phosphorylation results in counterclockwise rotation of flagella and makes the cell move forward. In contrast, phosphorylated CheY favors tumbling. The level of protein phosphorylation is regulated by certain attractant or repellent, which can bind specific receptors on the cell surface. Signals are then passed through a series of intracellular biochemical reactions, in which phosphorylation of CheY is controlled. In this way bacteria accomplish chemotactic behavior.

Escherichia coli is a common kind of engineer bacteria, which is convenient for genetic manipulation. It is likely that we make use of the chemotactic pathway in E.coli, making them detect and move toward a special chemical substance, maybe a certain kind of pollutant. If the genetic engineering strain also has the ability of degrading aimed chemicals, efficiency of pollution treatment can be hopefully improved a lot. However, the natural ligands concerning chemotaxis in E.coli are limited in several kinds of nutrition, such as carbohydrate and amino acids. Strains that can detecting more kinds of organic substances and even heavy metal ions is planed to be got through the reconstruction of chemotaxis system.

Tsinghua1.jpg

Overall project

This year we are trying to work at the motility of bacteria. E.coli senses some chemicals and moves toward or stays still, this behavior is called chemotaxis. Any modification of the pathway from the sensor to the motile apparatus will cause different chemotactic effcts.

Moreover,most of the biosensors today are designed for a specific target signal, and they can not substitute each other in most cases. By structural analysis we find that most receptors for the same type of ligands exhibit great similarity, both in sequence information and characteristics. Our project is designed for an "Interchangeable Biosensor". The strategy is almost trial and error, to find an appropriate pathway between chemical molecules and corresponding reactions. Signals other than chemicals are much harder to manipulate, and integrating all the signals seems even more challenging,we are trying to isolate the elements and standardize them.

Major inspiration of our idea comes from the Three Laws of Robotics(Isaac Asimov):

1. A robot may not injure a human being, or, through inaction, allow a human being to come to harm.

2. A robot must obey the orders given it by human beings except where such orders would conflict with the First Law.

3. A robot must protect its own existence as long as such protection does not conflict with the First or Second Law.


The goal is to be achieved via three different subprojects: CdLocalizer, DualReceptor and TheoRiboSwitch.

TheoRiboSwitch Project focuses on the verification of signals transmission between GCS and motor while DualReceptor Project focuses on the integration of multiple signals at the sensor and GCS sections. CdLocalizer Project is designed to illustrate a more complicated correlation other than linear correlation between ligand concentration and GCS.


Standardized Chemokactic Access Control and Modular Design of E.coli

One canonical chemotactic behavior is the response of Escherichia coli toward certain nutrition, which plays a key role in seeking food. Researchers have investigated thoroughly into the molecular mechanism of it.

Motility in prokaryotes is accomplished by flagellum, a complex structure moving the cell by rotation, much like the propeller in a motor boat. In E.coli, counterclockwise rotation moves the cell in a direction called a run, while clockwise rotation results in tumbling of the cell.

The direction of rotation is controlled by phosphorylation of CheY, a signaling protein in the chemotaxis pathway of E.coli. Low level of phosphorylation results in counterclockwise rotation of flagella and makes the cell move forward. In contrast, phosphorylated CheY favors tumbling.

The level of protein phosphorylation is regulated by certain attractant or repellent, which can bind specific receptors on the cell surface. Signals are then passed through a series of intracellular biochemical reactions, in which phosphorylation of CheY is controlled. In this way bacteria accomplish chemotactic behavior.

Molecular mechanism involve in chemotaxis behavior can be simplified into following schematics. There are several kinds of receptors for different chemotactic ligands on the membrane of E.coli. These receptors sense correspondent ligands and convert the concentration of each ligand to their activity. The total activity of them represents whether the bacterium like or hate a certain position in the environment. We name the sum of chemotactic receptors’ activity “General Chemotaxis Signal (GCS)”. Then the decision of chemotaxis is converted into CheY phosphorylation level, which controls rotation bias of molecular motor. Thus, concentration of CheY-p is called “Motor Control Signal (MCS)” here.


Bacterium2.pngBlock small2.jpg System Block Diagram of Chemotaxis

Different types of receptors sense the concentrations of various ligands and conform them to General Chemotaxis Signal (GCS), which represents the chemotaxis decision. The rest of chemotaxis pathway is in charge of convert GCS to MCS (Motor Control Signal), which interferences motor rotation bias. The working state of motor are directly related to the positions of bacteria in medium, and coordinate of bacterium corresponds to the concentration of ligands there. Bacteria sense real-time environmental conditions and regulate its movement model through this mechanism in order to find a place with highest fitness.


Status of the Three Experimental Programs in the Entire Study

TheoRiboSwitch Project

This program is mainly used to verify the design principle of signal pathway between GCS and MCS. As we have mentioned, the relation between GCS and MCS is not a simple positive correlation, but one similar to derivative relation. Their signaling pathway not only transfers the signal from some intermediates to another molecule which can interact with the motor, but also completes a similar calculation of derivation. In our study, by means of reverse engineering, we analyze the dynamic characteristics of E. coli natural chemokine pathways, and abstract the key factors which enable E.coli to guide chemokaxis. Then, on the basis of these dynamics, we modify our design for a new pathway, and verify it via computer simulation. As for the design of the final test, it must be directly linked with real E. coli, which is the final objective of this program. In the program, the concentration ligand and Ribo-switch complex corresponds to common chemokactic signals. This design does not involve the signal integration of a variety of substances, and their combination is a fast chemical balance, which minimizes the delay and makes this program a suitable verification for the second half of the entire design.

DualReceptor Project

The main purpose of this program is to integrate the two signals. Although in practice, the two receptors correspond to the same ligand, yet the relationship between the concentration of the ligand they mediate and GCS is just the opposite. Thus, this program can be seen as the integration (or trade-off) of the two signals. The same kind of ligand molecules are used to facilitate quantitative detection, and also to achieve a certain degree of practical significance (see description below). This program is Theophylline chemokaxis-based. A key issue needs to be addressed during the convergence of integration phase and transference phase of the signal: would the delay of signal in the first part of integration impact later signal transference? This requires proof based on theoretical analysis and simulation experiments in advance. Of course, we can also choose to establish only positive correlation between GCS and MCS, which can be called “pseudochemokaxis”, to avoid interference by the progress of the Theophylline Chemokaxis Program.

CdLocalizer Project

In this program, we attempt to establish a more complex function, rather than a simple positive correlation between ligand concentration and GCS. Although the ultimate application purpose of the program is the same with the Toluene Chemokaxis Program, a different design principle is used. Just like the Toluene Chemokaxis Program, this one is faced with the same signal-conversion delay problem. Still, we can use “pseudochemokaxis” to complete signal conversion of the second half of the whole process.

Wetlab Work

WetLab work

Simulation

Chemotaxis Modeling


Reference

1 Assessment of heavy metal bioavailability in contaminated sediments and soils using green fluorescent protein-based bacterial biosensors. Vivian Hsiu-Chuan Liao*, Ming-Te Chien, Yuen-Yi Tseng, Kun-Lin Ou. Environmental Pollution 142 (2006) 17e23

This literature helped us to introduce GFP into our project and gave us a description of heavy metal pollutants.

2 The C-terminal domain of the Escherichia coli RNA polymerase a subunit plays a role in the CI-dependent activation of the bacteriophage lambda pM promoter. Barbara Kedzierska , Anna Szambowska , Anna Herman-Antosiewicz , David J. Lee , Stephen J.W. Busby2, Grzegorz Wegrzyn1 and Mark S. Thomas3,* Nucleic Acids Research, 2007, Vol. 35, No. 7

This literature gives out a mechanism of CI-Pm promotor interaction.

3 Guiding Bacteria with Small Molecules and RNA.Shana Topp and Justin P. Gallivan. J. AM. CHEM. SOC. 2007, 129, 6807-6811 9

This literature lent us an overall vision of how bacteria movement happens and indicated out the central role of CheZ. It also introduced riboswitch into our project.

4 Luminescent bacterial sensor for cadmium and lead.Sisko Tauriainen, Matti Karp, Wei Chang, Marko Virta.Biosensors & Bioelectronics 13 (1998) 931–938

This literature descripted sensors for cadmium and lead.

5 Online and in situ monitoring of environmental pollutants: electrochemical biosensing of cadmium.I Biran, R Babai, K Levcov, J Rishpon, EZ Ron.Environmental Microbiology, 2000

This literature gives out a sensing and detecting method for cadmium.

6 Sensitivity of OR in Phage lambda.Audun Bakk, Ralf Metzler, and Kim Sneppen.Biophysical Journal Volume 86 January 2004 58–66

This literature explains the operation of operons in phage lambda.

7 An Artificial Aptazyme-Based Riboswitch and its Cascading System in E. coli. Atsushi Ogawa and Mizuo Maeda. ChemBioChem 2008, 9, 206 – 209

This is an indication of riboswitch.


Other reference

Goldstein RA & Soyer OS (2008) PLoS Comput Biol 4, e1000084.

Emonet T & Cluzel P (2008) Proc Natl Acad Sci U S A 105, 3304-3309.

Emonet T, Macal CM, North MJ, Wickersham CE, & Cluzel P (2005) Bioinformatics 21, 2714-2721.

Korobkova E, Emonet T, Vilar JM, Shimizu TS, & Cluzel P (2004) Nature 428, 574-578.

Sourjik V & Berg HC (2002) Proc Natl Acad Sci U S A 99, 123-127.

Yi TM, Huang Y, Simon MI, & Doyle J (2000) Proc Natl Acad Sci U S A 97, 4649-4653.

Lauffenburger DA (2000) Proc Natl Acad Sci U S A 97, 5031-5033.

Liu Z & Papadopoulos KD (1996) Biotechnol Bioeng 51, 120-125.

Ishihara A, Segall JE, Block SM, & Berg HC (1983) J Bacteriol 155, 228-237.

Cluzel P, Surette M, & Leibler S (2000) Science 287, 1652-1655.






HOME Team Project Parts Modelling Notebook Doodle Board
06.jpeg