Team:Harvard/Dailybook/Week0

From 2008.igem.org

Revision as of 17:33, 28 October 2008 by Joyy (Talk | contribs)

Contents

Monday: June 16, 2008

Meeting Notes

Tic-Tac-Toe

Basic Idea

  • Use a chemical signal to induce electric output
  • Use E. coli as detector, Shewie as indicator
  • Use E. coli to produce lactate, needed for e- production in Shewie

Logistics of Game

Person v. Person

  • Example game:
  1. Player 1 adds chemical
  2. Computer tracks electric output and displays move on screen
  3. Player 2 adds chemical
  4. Computer tracks electric output and displays move on screen
  5. Repeat
  • One chemical detection needed

Person v. Computer

  • Example game:
  1. Player 1 adds chemical
  2. Computer tracks electric output and displays move on screen
  3. Computer chooses its move and lights up the well that it decides to move to
  4. Bacteria respond in a certain way
  5. Repeat
  • One chemical detection and one light detection needed

Person v. Bacteria

  • Most complex, based off of DNA paper (See here)
  • Applying ideas from DNA paper to bacteria
  • Create 8 strains of different antibiotic resistances
  • More feasible in E. coli than in Shewie

Lab

  • picked colonies
  • rehydrated MR-1 shewie strain



Tuesday: June 17, 2008

  • GFP/OD Measurement (results)
  • Make glycerol stocks
  • Miniprep vectors (protocol)
  • Make competent Shewie
    • Chemically competent (protocol) - actually used Zymo protocol which didn't work for Shewie and I don't think for E. coli
    • Electrocompetent (protocol) - actually used earlier protocol w/o sorbitol
  • Pour Cm plates
  • Transform Shewie with pACYC Duet and GFP vectors
Name Registry Name Description Origin Size Marker
E1 J23113Low promoter GFP testerpMB135Kan
E2 J23150Medium promoter GFP testerpMB135Kan
E3 J23151High promoter GFP testerpMB135Kan
E4 pACYC duetLow-Medium copy vectorp15a4008Cm
For list of all parts, see here.


  • Plasmid DNA Concentrations after Miniprep
Name Registry Name Concentration (ng/uL)
E1a J2311367.1
E1b J2311376.2
E2a J2315045.4
E2b J2315072.4
E3a J2315141.8
E3b J2315168.5
For list of all parts, see here.

Wednesday: June 18, 2008

Protocols

  • Cloning Strategy
    • Punch out from registry
Name Registry Name Description Origin Size Marker
E5 pSB3K3Low-Medium copy vectorp15a2750Kan
E6 BBa-E1010RFP onlypMB1681Kan
E7 pSB1A2GFP onlypMB12079Amp
E8 BBa_J04450RFP with LacI promoterpMB11069Amp
E9 BBa_J04430GFP with LacI promoterpMB11083Amp
E10 BBa_I715038T7 Polymerase with LacI promoterpMB12878Amp
For list of all parts, see here.
  • transform into E. coli TOP10 cells
  • Make chemically and electrocompetent Shewie MR-1
  • Transform electrocompetent Shewie MR-1 and E. coli
    • P3, P4, P5, A1 in shewie
    • P3, P4, A1 in E. coli (TOP10)


Results

  • Results for Tuesday's (6/17) transformations
    • Results for Electrocompetent cells (first procedure no sorbitol)
      • P4 (pACYC) worked for both Shewie and E. coli; E. coli had a much higher density of colonies
      • None of the other plasmids worked for either Shewie or E. coli cells grew (likely due to low concentrations of cells)
    • Results for Chemically competent cells (w/ Zymo procedure)
      • No Shewie (5) or E. coli (2) cells grew


Thursday: June 19, 2008

Results from Electroporated Shewie and E. coli plates

  • Shewie
    • P3 J23151 (Kan) colonies grew and expressed GFP; colonies may have a pinkish tint; unexpected b/c origin of replication
    • P4 pACYC-Duet (Cm) colonies grew
    • P5 pSB3K3 (Kan) no growth, possibly due to the very small volume of DNA added
    • A1 (Cm) a few colonies grew
  • TOP10
    • P3 J23151 (Kan) - colonies grew
    • P4 pACYC-Duet (Cm) - a little growth
    • A1 (Cm) - colonies grew

Results TOP10 transformations w/ registry parts

  • P4 lawn
  • P5 no growth?
  • P6 no growth?
  • P7 many small colonies
  • P8 many small colonies
  • P9 many small colonies
  • P10 many small colonies

Transformed Chemically Competent Cells from Wed 6/18

Restreaking electroporated E. coli plates

Some plates were overgrown (lawns/colonies too dense), so they were replated

  • P4 pACYC-Duet (Cm) restreaked from lawn onto 1000x dilution chloramphenicol plate)
  • P7 pSB1A2 one big and one small colony onto 2 ampicillin plates
  • P8 BBa_J04450 one big and one small colony onto 2 ampicillin plates
  • P9 BBa_J04430 one big and one small colony onto 2 ampicillin plates
  • P10 BBa_I715038 one big and one small colony onto 2 ampicillin plates

Some plates didn't have any visible colonies


S1 & E1 DNA Alignment

Thu Jun 19 15:45:18 2008
E. coli K12-DH108 from 1 to 1542
Alignment to
Shewanella oneidensis MR-1 from 1 to 1529
Matches(|):1384
Mismatches(#):95
Gaps( ):113
Unattempted(.):0

Primers

Sequence Location
To distinguish S1
Forward tcttgaacactgggctctca 831-850
Reverse cttatttgccagcacgtaat 1111-1130
attacgtgctggcaaataag reverse complement for reverse primer
To distinguish E1
Forward acagaactttccagagatgg 999-1018
Reverse agcaagcggacctcataaag 1271-1290
ctttatgaggtccgcttgct reverse complement for reverse primer
Common Primer
Forward ttgggttaagtcccgcaacg 1085-1104
Reverse aatcgtggatcagaatgcca 1341-1360
tggcattctgatccacgatt reverse complement for reverse primer
    1 aaattgaagagtttgatcatggctcagattgaacgctggcggcaggcctaacacatgcaa 60    
      |         ||||||||||||||||||||||||||||||||||||||||||||||||||       
    1 a---------gtttgatcatggctcagattgaacgctggcggcaggcctaacacatgcaa 51    

61 gtcgaacggta--ac-ag-gaagaagcttgct--tc-tttgctgacgagtggcggacggg 113 |||||#|||#| || || | || || | || |##|#||#||||#|||||||||| 52 gtcgagcggcagcacaagtg-ag----tt--tactcatgaggtggcgagcggcggacggg 104

114 tgagtaatgtct-gggaaactgcctga-tggagggggataacta-ctggaaacggta--g 168 |||||||||#|| ||| |#||||| #| |#|||||||||||| | #|||||||| | | 105 tgagtaatgcctaggg-atctgcc-cagtcgagggggataac-agttggaaacg--actg 159

169 ctaataccgcataacgtcgc--a-agaccaaagagggggaccttcgggcctcttgccatc 225 |||||||||||| ||| | | | #|###||||||||||||#|||||||||||#||#||# 160 ctaataccgcat-acg-c-cctacgggggaaagagggggactttcgggcctctcgcgatt 216

226 ggatgtgcccagatgggattagctagtaggtggggtaacggctcacctaggcgacgatcc 285 |||||##||#||#||||||||||||||#||||#|||||#||||||||#|||||||||||| 217 ggatgaacctaggtgggattagctagttggtgaggtaatggctcaccaaggcgacgatcc 276

286 ctagctggtctgagaggatgaccagccacactggaactgagacacggtccagactcctac 345 |||||||#|||||||||||||#||||||||||||#||||||||||||#|||||||||||| 277 ctagctgttctgagaggatgatcagccacactgggactgagacacggcccagactcctac 336

346 gggaggcagcagtggggaatattgcacaatgggcgcaagcctgatgcagccatgccgcgt 405 |||||||||||||||||||||||||||||||||#|#||#||||||||||||||||||||| 337 gggaggcagcagtggggaatattgcacaatgggggaaaccctgatgcagccatgccgcgt 396

406 gtatgaagaaggccttcgggttgtaaagtactttcagcggggagg-aagggagtaaagt- 463 ||#|||||||||||||||||||||||||#||||||||##|||||| |||| || |||| 397 gtgtgaagaaggccttcgggttgtaaagcactttcagtagggaggaaagg--gt-aagtc 453

464 -taatac--ctt-tgctcattgacgttacccgcagaagaagcaccggctaactccgtgcc 519 |||||| ||| | || #||||||||||##|||||||||#|||||||||||||||||| 454 ctaatacgacttat-ct--gtgacgttacctacagaagaaggaccggctaactccgtgcc 510

520 agcagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgca 579 ||||||||||||||||||||||||#|#|||||||||||||||||||||||||||||||## 511 agcagccgcggtaatacggagggtccgagcgttaatcggaattactgggcgtaaagcgtg 570

580 cgcaggcggtttgttaagtc-agatgtgaaatccccgggctcaacctgggaact-gcatc 637 |||||||||||||||||| | ||||||||||#|||#|||||||||||#|||| | |||| 571 cgcaggcggtttgttaag-cgagatgtgaaagccctgggctcaacctaggaa-tcgcat- 627

638 t--gatactg-gcaagcttgagtctcgtagaggggggtagaattccaggtgtagcggtga 694 | || |||| #||| ||#||||||#|||||||||||||||||||||||||||||||||| 628 ttcga-actgaccaa-ctagagtcttgtagaggggggtagaattccaggtgtagcggtga 685

695 aatgcgtagagatctggaggaataccggtggcgaaggcggccccctggacgaagactgac 754 ||||||||||||||||||||||||||||||||||||||||||||||||||#||||||||| 686 aatgcgtagagatctggaggaataccggtggcgaaggcggccccctggacaaagactgac 745

755 gctcaggtg--cgaaagcgtggggagcaaacaggattagataccctggtagtccacgccg 812 ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| 746 gctca--tgcacgaaagcgtggggagcaaacaggattagataccctggtagtccacgccg 803

813 taaacgatgtcgacttggaggtt--gtgcccttgaggc-gt-ggct-tccggagctaacg 867 |||||||||||#|||#||| ||| ||| #||||| #| #| |||| || #|||||||| 804 taaacgatgtctactcgga-gtttggtg-tcttga-acactgggctctc--aagctaacg 858

868 cgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacggg 927 |#||||||#||||||||||||||||||||||||||||||||||||||||||||||||||| 859 cattaagtagaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacggg 918

928 ggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctg 987 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||# 919 ggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttaccta 978

988 gtcttgacatccacaga--actttccagagatg-gattggtgccttcgggaactgtgaga 1044 #|||||||||||||#|| || |#|||||||| |#|| ||||||||||||||#|||||| 979 ctcttgacatccacggaagac--tgcagagatgcggtt-gtgccttcgggaaccgtgaga 1035

1045 caggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacg 1104 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1036 caggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacg 1095

1105 agcgcaacccttat-ctt-ttgttgccagc-ggt-ccggccgggaactcaaaggagactg 1160 ||||||||||#||| ||| | |||||||| #|| ##|| #||||||||#|#|||||||| 1096 agcgcaacccctatccttat--ttgccagcacgtaatgg-tgggaactctagggagactg 1152

1161 ccagtgataaactggaggaaggtggggatgacgtcaagtcatcatggcccttacgaccag 1220 ||#|||||||||#|||||||||||||||#|||||||||||||||||||||||||||##|| 1153 ccggtgataaaccggaggaaggtggggacgacgtcaagtcatcatggcccttacgagtag 1212

1221 ggctacacacgtgctacaatggcgca-tacaaagag-------aagcgacctcgcgagag 1272 |||||||||||||||||||||||| | ||| |||| |||| |||||| | 1213 ggctacacacgtgctacaatggcg-agtac--agagggttgcaaagc-----cgcgag-g 1263

1273 -caagcggacctcataaag-tgcgtcgtagtccggattggagtctgcaactcgactccat 1330 ##|||##|#||||#|||| | |||||||||||||||||||||||||||||||||||||| 1264 tggagctaatctcacaaagct-cgtcgtagtccggattggagtctgcaactcgactccat 1322

1331 gaagtcggaatcgctagtaatcgtggatcagaatgccacggtgaatacgttcccgggcct 1390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1323 gaagtcggaatcgctagtaatcgtggatcagaatgccacggtgaatacgttcccgggcct 1382

1391 tgtacacaccgcccgtcacaccatgggagtgggttgcaaaagaagtaggtagcttaacct 1450 |||||||||||||||||||||||||||||||||#||||||||||||#||||||||||||| 1383 tgtacacaccgcccgtcacaccatgggagtgggctgcaaaagaagtgggtagcttaacct 1442

1451 tcgggagggcgcttaccactttgtgattcatgactggggtgaagtcgtaacaaggtaacc 1510 |||||#|||||||#|||||||||||#|||||||||||||||||||||||||||||||#|| 1443 tcgggggggcgctcaccactttgtggttcatgactggggtgaagtcgtaacaaggtagcc 1502

1511 gtaggggaacctgcggttggatcacctcctta 1542 #||||||||||||#||#|||||||||| 1503 ctaggggaacctggggctggatcacct 1529

Transforming TOP 10 with the light sensor biobrick

We attempted to transform TOP 10 E. coli with the light sensor biobrick (to make P11). No colonies were visible the next morning. This is perhaps because the DNA turned pink after being punched out of the notebook.


Friday: June 20, 2008

Results from Thursday 6/19 Transformations

  • Shewie - no growth
  • E. coli
    • P3 lawn
    • P4 lawn
    • P5 no growth
    • P6 no growth

Meeting with Orianna Bretschger

Transformed S1 via Electroporation

We used the electroporation protocol as noted in General Protocols with the following volumes of vector added:

  • P1 (J23113 low) - 2uL
  • P2 (J23150 med) - 2uL
  • P3 (J23151 high) - 2uL
  • P12 (pET Duet-1) - 5uL
  • P13 (pCDF Duet) - 1uL
  • P14 (pCOLA Duet) - 1uL

Put on the following plates at 30 degrees C over the weekend:

  • P1 (J23113 low) - Kan
  • P2 (J23150 med) - Kan
  • P3 (J23151 high) - Kan
  • P12 (pET Duet-1) - Amp
  • P13 (pCDF Duet) - Sm
  • P14 (pCOLA Duet) - Kan

Transformation of plasmids 11 and 15-20

Chemically competent E. coli DH5a were transformed with plasmids 15-20. Additionally, p11 was repeated.

  • We noticed that after punching out the holes from the notebook, the DNA usually turned purple. The DNA that remained yellow turned purple after adding EB buffer. The protocol in the notebook recommends heating the EB buffer before use, but we did not do this. Instead, we incubated the DNA and EB buffer for 20 minutes at 42 °C (instead of at room temperature).
  • Additionally, due to time constraints, we only incubated the DNA and bacteria in SOC medium for 1 hour.

Widget

Materials purchased

From McMaster-Carr

Qty. Part
1 Titanium Grade 2 Wire .046" Diameter, 1/8-lb Coil, 38' Coil
1 ft Polycarbonate Round Tube 3" OD, 2-5/8" ID, Clear
1 ft Polycarbonate Square Tube 1"
1 ft Polycarbonate Square Tube 2" OD
1 ft Polycarbonate Round Tube 2" OD, 1-7/8" ID, Clear
2
(pack of 10)
Plastic Quick-Turn(Luer Lock) Coupling Nylon, Female X Male Thread, 1/4"-28 Unf Thread
2
(pack of 10)
Plastic Quick-Turn(Luer Lock) Coupling Nylon, Male X Barb, for 3/16" Tube ID
1 Military Grade Pipe Thread Sealant Tape Premium, 43' Length X 1/2" Width, Light Green
1 Military Grade Pipe Thread Sealant Tape Premium, 43' Length X 1/4" Width, Light Orange

From FuelCellStore

Qty. Part
1
10x10cm
E-TEK ELAT™ GDE LT120EW: Low Temperature E-TEK ELAT™ GDE microporous layer
including Pt electrode on woven web, thin configuration

Equipment Purchased

From Keithley

Model No. Description
2700 Model 2700 DMM, Data Acquisition, Datalogging System w/ 2 Slots
7700 Model 7700 20-Channel, Differential Multiplexer Module w/ Automatic CJC, Screw Terminals, and up to 50MHz Bandwidth (for Models 2700, 2701, and 2750)