http://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&feed=atom&action=historyTeam:LCG-UNAM-Mexico/Notebook/2008-June 2 - Revision history2024-03-28T17:45:23ZRevision history for this page on the wikiMediaWiki 1.16.5http://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=84127&oldid=prevCvargas at 01:12, 29 October 20082008-10-29T01:12:31Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 01:12, 29 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 124:</td>
<td colspan="2" class="diff-lineno">Line 124:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><td class="bodyText"><div align="justify"><p><strong>Final design</strong></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><td class="bodyText"><div align="justify"><p><strong<ins class="diffchange diffchange-inline">><u</ins>>Final design<ins class="diffchange diffchange-inline"></u></ins></strong></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Scheme</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Scheme</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><div id="pbfw"></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><div id="pbfw"></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 620:</td>
<td colspan="2" class="diff-lineno">Line 620:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><td class="bodyText"><div align="justify"><p><strong>MODELING:</strong><br></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><td class="bodyText"><div align="justify"><p><strong<ins class="diffchange diffchange-inline">><u</ins>>MODELING:<ins class="diffchange diffchange-inline"></u></ins></strong><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <strong id="j4px695"><img src="http://docs.google.com/File?id=dntmktb_59hmv4brc3_b" alt="" name="graphics3" width="255" height="289" hspace="13" border="0" align="left" id="j4px696" /></strong><br><strong>Variables</strong> <br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <strong id="j4px695"><img src="http://docs.google.com/File?id=dntmktb_59hmv4brc3_b" alt="" name="graphics3" width="255" height="289" hspace="13" border="0" align="left" id="j4px696" /></strong><br><strong>Variables</strong> <br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> Concentrations of:</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> Concentrations of:</p></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 699:</td>
<td colspan="2" class="diff-lineno">Line 699:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><td class="bodyText"><div align="justify"><p><p><strong>WET LAB:</strong></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><td class="bodyText"><div align="justify"><p><p><strong<ins class="diffchange diffchange-inline">><u</ins>>WET LAB:<ins class="diffchange diffchange-inline"></u></ins></strong></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> 2. Once you have the sequence find appropriate reading frames <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> 2. Once you have the sequence find appropriate reading frames <br /></div></td></tr>
</table>Cvargashttp://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=76730&oldid=prevCvargas at 09:36, 28 October 20082008-10-28T09:36:25Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 09:36, 28 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 124:</td>
<td colspan="2" class="diff-lineno">Line 124:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><td class="bodyText"><p><strong>Final design</strong></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><td class="bodyText<ins class="diffchange diffchange-inline">"><div align="justify</ins>"><p><strong>Final design</strong></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Scheme</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>Scheme</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><div id="pbfw"></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><div id="pbfw"></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 614:</td>
<td colspan="2" class="diff-lineno">Line 614:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> NOTES: For LuxR to bind HSL and enable the transcription of cI, HLS should be at a micromolar concentration.<br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> NOTES: For LuxR to bind HSL and enable the transcription of cI, HLS should be at a micromolar concentration.<br /></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> Not all bioparts have been previously used, most DNA is available but there is still no record their functionality. We need to evaluate the DNA quality to ensure that there will be no problems.</p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> Not all bioparts have been previously used, most DNA is available but there is still no record their functionality. We need to evaluate the DNA quality to ensure that there will be no problems.</p<ins class="diffchange diffchange-inline">></div</ins>></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr> </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><tr></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 620:</td>
<td colspan="2" class="diff-lineno">Line 620:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><td class="bodyText"><p><strong>MODELING:</strong><br></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><td class="bodyText<ins class="diffchange diffchange-inline">"><div align="justify</ins>"><p><strong>MODELING:</strong><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <strong id="j4px695"><img src="http://docs.google.com/File?id=dntmktb_59hmv4brc3_b" alt="" name="graphics3" width="255" height="289" hspace="13" border="0" align="left" id="j4px696" /></strong><br><strong>Variables</strong> <br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <strong id="j4px695"><img src="http://docs.google.com/File?id=dntmktb_59hmv4brc3_b" alt="" name="graphics3" width="255" height="289" hspace="13" border="0" align="left" id="j4px696" /></strong><br><strong>Variables</strong> <br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> Concentrations of:</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> Concentrations of:</p></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 693:</td>
<td colspan="2" class="diff-lineno">Line 693:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> RcnA -&gt; Ø </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> RcnA -&gt; Ø </p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p align="center">&nbsp;</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p align="center">&nbsp;</p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> </td></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> <ins class="diffchange diffchange-inline"></div></ins></td></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr> </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><tr></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 699:</td>
<td colspan="2" class="diff-lineno">Line 699:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><td class="bodyText"><p><p><strong>WET LAB:</strong></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><td class="bodyText<ins class="diffchange diffchange-inline">"><div align="justify</ins>"><p><p><strong>WET LAB:</strong></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> 2. Once you have the sequence find appropriate reading frames <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> 2. Once you have the sequence find appropriate reading frames <br /></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 724:</td>
<td colspan="2" class="diff-lineno">Line 724:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><em><b>Transforming bioparts:</b> </em><br>Bacteria needed to extract DNA plasmid. Centrifuge, wash and put solution 1. Glucose, TRIS, EDTA and sometimes RNAs 1. Sodium hydroxide and SDS in the solution 2, sodium hydroxide denatures the DNA. Solution 3 with sodium acetate neutralizes the base. Wash and dry every time.</p></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><em><b>Transforming bioparts:</b> </em><br>Bacteria needed to extract DNA plasmid. Centrifuge, wash and put solution 1. Glucose, TRIS, EDTA and sometimes RNAs 1. Sodium hydroxide and SDS in the solution 2, sodium hydroxide denatures the DNA. Solution 3 with sodium acetate neutralizes the base. Wash and dry every time.</p></p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> </td></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> <ins class="diffchange diffchange-inline"></div></ins></td></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr> </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr> </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
</table>Cvargashttp://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=76381&oldid=prevCrobles at 08:21, 28 October 20082008-10-28T08:21:26Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 08:21, 28 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 75:</td>
<td colspan="2" class="diff-lineno">Line 75:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <td width="224" valign="top" bgcolor="#5C743D"></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <td width="224" valign="top" bgcolor="#5C743D"></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline"> </del><table border="0" cellspacing="0" cellpadding="0" width="165" id="navigation"></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"> </ins><table border="0" cellspacing="0" cellpadding="0" width="165" id="navigation"></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D">&nbsp;<br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D">&nbsp;<br /></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 84:</td>
<td colspan="2" class="diff-lineno">Line 84:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/<del class="diffchange diffchange-inline">Team</del>" class="navText"><del class="diffchange diffchange-inline">About Us</del></a></td></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/<ins class="diffchange diffchange-inline">Project</ins>" class="navText"><ins class="diffchange diffchange-inline">Our project</ins></a></td></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/<del class="diffchange diffchange-inline">Project</del>" class="navText"><del class="diffchange diffchange-inline">Our Project</del></a></td></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/<ins class="diffchange diffchange-inline">Modeling</ins>" class="navText"><ins class="diffchange diffchange-inline">Modeling</ins></a></td></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Experiments" class="navText"><del class="diffchange diffchange-inline">Experiments</del></a></td></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Experiments" class="navText"><ins class="diffchange diffchange-inline">Wet Lab</ins></a></td></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 96:</td>
<td colspan="2" class="diff-lineno">Line 96:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/<del class="diffchange diffchange-inline">Modeling</del>" class="navText"><del class="diffchange diffchange-inline">Modeling</del></a></td></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/<ins class="diffchange diffchange-inline">Notebook</ins>" class="navText"><ins class="diffchange diffchange-inline">Notebook</ins></a></td></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/<del class="diffchange diffchange-inline">Notebook</del>" class="navText"><del class="diffchange diffchange-inline">Notebook</del></a></td></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/<ins class="diffchange diffchange-inline">Story</ins>" class="navText"><ins class="diffchange diffchange-inline">Our story</a></td></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"> </tr></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"> <tr></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"> <td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Team" class="navText">About us</ins></a></td></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline"> </del></table></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"> </ins></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline"> </del><br /></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline"> </ins></table> <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> &nbsp;<br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> &nbsp;<br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> &nbsp;<br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> &nbsp;<br /></div></td></tr>
</table>Crobleshttp://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=73914&oldid=prevCvargas at 21:45, 27 October 20082008-10-27T21:45:08Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 21:45, 27 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 617:</td>
<td colspan="2" class="diff-lineno">Line 617:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><td class="bodyText"><p><strong><del class="diffchange diffchange-inline">Modeling</del></strong><br></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><td class="bodyText"><p><strong><ins class="diffchange diffchange-inline">MODELING:</ins></strong><br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <strong id="j4px695"><img src="http://docs.google.com/File?id=dntmktb_59hmv4brc3_b" alt="" name="graphics3" width="255" height="289" hspace="13" border="0" align="left" id="j4px696" /></strong><br><strong>Variables</strong> <br></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <strong id="j4px695"><img src="http://docs.google.com/File?id=dntmktb_59hmv4brc3_b" alt="" name="graphics3" width="255" height="289" hspace="13" border="0" align="left" id="j4px696" /></strong><br><strong>Variables</strong> <br></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> Concentrations of:</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> Concentrations of:</p></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 696:</td>
<td colspan="2" class="diff-lineno">Line 696:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><td class="bodyText"><p><p><strong><del class="diffchange diffchange-inline">Wet Lab</del></strong></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><td class="bodyText"><p><p><strong><ins class="diffchange diffchange-inline">WET LAB:</ins></strong></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> 2. Once you have the sequence find appropriate reading frames <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> 2. Once you have the sequence find appropriate reading frames <br /></div></td></tr>
</table>Cvargashttp://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=73391&oldid=prevCvargas at 20:00, 27 October 20082008-10-27T20:00:33Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 20:00, 27 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 697:</td>
<td colspan="2" class="diff-lineno">Line 697:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><td class="bodyText"><p><p><strong>Wet Lab</strong></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><td class="bodyText"><p><p><strong>Wet Lab</strong></p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del style="color: red; font-weight: bold; text-decoration: none;"><p>&nbsp;</p></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> 2. Once you have the sequence find appropriate reading frames <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> 2. Once you have the sequence find appropriate reading frames <br /></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 707:</td>
<td colspan="2" class="diff-lineno">Line 706:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In <a href= http://fruitfly.org:9005/seq_tools/promoter.html> fruitfly.org: 9005/seq_tools/promoter.html </a>we can look for primers and we can adjust parameters. We can also analyze the stability energy, and seek the lowest point of stability. This point is generally the -10box. To find inverted repeats, we shall use the program StemLoop of the parcel of GCG (genetics computer group). This program calls in the sequence in a GCG format. To find direct repeats we will use the program &quot;repeat&quot;. For rcnR and rcnA we found three direct repeats between the -10 box and the translation start of rcnA.We suggest that this is a regulatory region. Based on this, we designed the primers, trying to preserve the regulatory region and changing its promoter.</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>In <a href= http://fruitfly.org:9005/seq_tools/promoter.html> fruitfly.org: 9005/seq_tools/promoter.html </a>we can look for primers and we can adjust parameters. We can also analyze the stability energy, and seek the lowest point of stability. This point is generally the -10box. To find inverted repeats, we shall use the program StemLoop of the parcel of GCG (genetics computer group). This program calls in the sequence in a GCG format. To find direct repeats we will use the program &quot;repeat&quot;. For rcnR and rcnA we found three direct repeats between the -10 box and the translation start of rcnA.We suggest that this is a regulatory region. Based on this, we designed the primers, trying to preserve the regulatory region and changing its promoter.</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p><em>Primer design.</em> The region should be rich in GC, of about 20 nucleotides with a 50% GC content at least and it should finish in G. The program can also show the double chain to facilitate the design of oligo lower. If they are rich in AT, they can be longer primers to increase its Tm. </p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p><em<ins class="diffchange diffchange-inline">><b</ins>>Primer design.<ins class="diffchange diffchange-inline"></b></ins></em<ins class="diffchange diffchange-inline">><br</ins>> The region should be rich in GC, of about 20 nucleotides with a 50% GC content at least and it should finish in G. The program can also show the double chain to facilitate the design of oligo lower. If they are rich in AT, they can be longer primers to increase its Tm. </p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The most popular program at the center is Oligo. Here we open a new window and paste the sequence. This will open two windows. The first one with the Tm, and the other one with the free energy. The program can calculate all oligos and show potential couples with its parameters. We can also specify were we want the oligo to be located. Once the program generates it, we can analyze its biochemical properties. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The most popular program at the center is Oligo. Here we open a new window and paste the sequence. This will open two windows. The first one with the Tm, and the other one with the free energy. The program can calculate all oligos and show potential couples with its parameters. We can also specify were we want the oligo to be located. Once the program generates it, we can analyze its biochemical properties. </p></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 721:</td>
<td colspan="2" class="diff-lineno">Line 720:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The contents of the tube will be put in an eppendorf, we centrifuge and then we withdraw the liquid medium with a syringe. Before we lyse de cells, we need to wash with TE 10 1 (Tris 10uM EDTA 1uM), with pH 8. Vortex, to separate and disintegrate. Again, we centrifuge and remove supernatant. To lyse, we add 400-450 ul TE5020pH8 and SDS 10% and K proteinase. We leave it at 37 degrees for 20 minutes. The medium goes from an opaque color to a light color when lysis happens. We add ethanol 100% once we have lysed the cells and we vortex. In the presence of ethanol DNA is precipitated, so we add 1ml of ethanol. Then we centrifuge for a few minutes and we have pellet. We wash three times with ethanol 70%, which solubilised salts and the small molecules (including RNA). We remove all the ethanol, this tube is placed in a specific centrifuge. The vacuum from this centrifuge will remove the remain solvent. It is necessary to remove all the ethanol, because this affects the pH. TE 10 1 RNAs 10mg per ml, this Stock solution is divided 1000 times and 50ul approx are added. To check the quality of the DNA extracted, we use an agarose gel.</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>The contents of the tube will be put in an eppendorf, we centrifuge and then we withdraw the liquid medium with a syringe. Before we lyse de cells, we need to wash with TE 10 1 (Tris 10uM EDTA 1uM), with pH 8. Vortex, to separate and disintegrate. Again, we centrifuge and remove supernatant. To lyse, we add 400-450 ul TE5020pH8 and SDS 10% and K proteinase. We leave it at 37 degrees for 20 minutes. The medium goes from an opaque color to a light color when lysis happens. We add ethanol 100% once we have lysed the cells and we vortex. In the presence of ethanol DNA is precipitated, so we add 1ml of ethanol. Then we centrifuge for a few minutes and we have pellet. We wash three times with ethanol 70%, which solubilised salts and the small molecules (including RNA). We remove all the ethanol, this tube is placed in a specific centrifuge. The vacuum from this centrifuge will remove the remain solvent. It is necessary to remove all the ethanol, because this affects the pH. TE 10 1 RNAs 10mg per ml, this Stock solution is divided 1000 times and 50ul approx are added. To check the quality of the DNA extracted, we use an agarose gel.</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p><em>Transforming bioparts: </em>Bacteria needed to extract DNA plasmid. Centrifuge, wash and put solution 1. Glucose, TRIS, EDTA and sometimes RNAs 1. Sodium hydroxide and SDS in the solution 2, sodium hydroxide denatures the DNA. Solution 3 with sodium acetate neutralizes the base. Wash and dry every time.</p></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p><em<ins class="diffchange diffchange-inline">><b</ins>>Transforming bioparts:<ins class="diffchange diffchange-inline"></b> </ins></em<ins class="diffchange diffchange-inline">><br</ins>>Bacteria needed to extract DNA plasmid. Centrifuge, wash and put solution 1. Glucose, TRIS, EDTA and sometimes RNAs 1. Sodium hydroxide and SDS in the solution 2, sodium hydroxide denatures the DNA. Solution 3 with sodium acetate neutralizes the base. Wash and dry every time.</p></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </td></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </td></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr> </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr> </div></td></tr>
</table>Cvargashttp://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=73373&oldid=prevCvargas at 19:56, 27 October 20082008-10-27T19:56:21Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 19:56, 27 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 696:</td>
<td colspan="2" class="diff-lineno">Line 696:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> </tr></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <tr></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><td class="bodyText"><p><p><strong>Wet Lab/strong></p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><td class="bodyText"><p><p><strong>Wet Lab<ins class="diffchange diffchange-inline"><</ins>/strong></p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>1. Take the sequences (fasta format) <br /></div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 705:</td>
<td colspan="2" class="diff-lineno">Line 705:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> We have to take the whole sequence in fasta format and use it in a program called Gene Construction Kit. This shows reading frames and restriction sites. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> We have to take the whole sequence in fasta format and use it in a program called Gene Construction Kit. This shows reading frames and restriction sites. </p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p>In fruitfly.org: 9005/seq_tools/promoter.html we can look for primers and we can adjust parameters. We can also analyze the stability energy, and seek the lowest point of stability. This point is generally the -10box. To find inverted repeats, we shall use the program StemLoop of the parcel of GCG (genetics computer group). This program calls in the sequence in a GCG format. To find direct repeats we will use the program &quot;repeat&quot;. For rcnR and rcnA we found three direct repeats between the -10 box and the translation start of rcnA.We suggest that this is a regulatory region. Based on this, we designed the primers, trying to preserve the regulatory region and changing its promoter.</p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p>In <ins class="diffchange diffchange-inline"><a href= http://</ins>fruitfly.org:9005/seq_tools/promoter.html<ins class="diffchange diffchange-inline">> fruitfly.org: 9005/seq_tools/promoter.html </a></ins>we can look for primers and we can adjust parameters. We can also analyze the stability energy, and seek the lowest point of stability. This point is generally the -10box. To find inverted repeats, we shall use the program StemLoop of the parcel of GCG (genetics computer group). This program calls in the sequence in a GCG format. To find direct repeats we will use the program &quot;repeat&quot;. For rcnR and rcnA we found three direct repeats between the -10 box and the translation start of rcnA.We suggest that this is a regulatory region. Based on this, we designed the primers, trying to preserve the regulatory region and changing its promoter.</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p>&nbsp;</p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><em>Primer design.</em> The region should be rich in GC, of about 20 nucleotides with a 50% GC content at least and it should finish in G. The program can also show the double chain to facilitate the design of oligo lower. If they are rich in AT, they can be longer primers to increase its Tm. </p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p><em>Primer design.</em> The region should be rich in GC, of about 20 nucleotides with a 50% GC content at least and it should finish in G. The program can also show the double chain to facilitate the design of oligo lower. If they are rich in AT, they can be longer primers to increase its Tm. </p></div></td></tr>
</table>Cvargashttp://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=73333&oldid=prevCvargas at 19:44, 27 October 20082008-10-27T19:44:41Z<p></p>
<a href="http://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=73333&oldid=69614">Show changes</a>Cvargashttp://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=69614&oldid=prevCvargas at 21:19, 26 October 20082008-10-26T21:19:30Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 21:19, 26 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 127:</td>
<td colspan="2" class="diff-lineno">Line 127:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div></div></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p align="center"><br /></p></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p align="center"><br /></p></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><p>The first plasmid contains the efflux pump for Nickel (rcnA), which will maintain its natural regulation dependent of <del class="diffchange diffchange-inline">metal (by </del>RcnR<del class="diffchange diffchange-inline">) </del>and additionally, it will contain a promoter regulated by the repressor of lambda phage, cI. <del class="diffchange diffchange-inline">Besides, </del>of <del class="diffchange diffchange-inline">course, </del>a resistance as a marker of the plasmid. </p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><p>The first plasmid contains the efflux pump for Nickel (rcnA), which will maintain its natural regulation dependent of RcnR and additionally, it will contain a promoter regulated by the repressor of lambda phage, cI. <ins class="diffchange diffchange-inline">In addition </ins>of a resistance as a marker of the plasmid. </p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p> </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p> </div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> The second contains everything needed for regulating <del class="diffchange diffchange-inline">the power down from </del>an external signal (AHL). Both luxR as aiiA will <del class="diffchange diffchange-inline">occur </del>constitutively, the first one, with a strong promoter (pTetR), as we do not want the presence of LuxR to be limiting, and the second one, having a moderate <del class="diffchange diffchange-inline">promoter </del>or weak (pLacZ), to give us space to play with concentrations <del class="diffchange diffchange-inline"> </del>of AHL without aiiA always <del class="diffchange diffchange-inline">wining</del>. And cI *, cI modified with <del class="diffchange diffchange-inline">a queue of </del>LVA for rapid degradation, regulated by a promoter dependent of LuxR + AHL. It will also contain <del class="diffchange diffchange-inline">an equal </del>resistance as a marker. </p></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> The second <ins class="diffchange diffchange-inline">plasmid </ins>contains everything needed for regulating <ins class="diffchange diffchange-inline">RcnA dependent on </ins>an external signal (AHL). Both luxR as aiiA will <ins class="diffchange diffchange-inline">be synthesised </ins>constitutively, the first one, with a strong promoter (pTetR), as we do not want the presence of LuxR to be limiting, and the second one, having a moderate or weak <ins class="diffchange diffchange-inline">promoter </ins>(pLacZ), to give us space to play with concentrations of AHL without aiiA always <ins class="diffchange diffchange-inline">degrading it all</ins>. And cI *, cI modified with <ins class="diffchange diffchange-inline">an </ins>LVA <ins class="diffchange diffchange-inline">tail </ins>for rapid degradation, regulated by a promoter dependent of LuxR + AHL. It will also contain <ins class="diffchange diffchange-inline">a </ins>resistance as a marker. </p></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p> </div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><p> </div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div> <del class="diffchange diffchange-inline">In the presence of </del>AHL, <del class="diffchange diffchange-inline">this joins with </del>LuxR and <del class="diffchange diffchange-inline">induces </del>the production of cI *, which in turn represses the transcription of rcnA. Like cI *, signal AHL <del class="diffchange diffchange-inline">has to </del>be short-lived since aiiA is degradating constantly, so the system quickly <del class="diffchange diffchange-inline"> </del>returns to its initial state <del class="diffchange diffchange-inline">once it ceases to manage AHL</del>. <br /></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div> <ins class="diffchange diffchange-inline">When </ins>AHL <ins class="diffchange diffchange-inline">is added</ins>, <ins class="diffchange diffchange-inline">it will join </ins>LuxR and <ins class="diffchange diffchange-inline">induce </ins>the production of cI *, which in turn represses the transcription of rcnA. Like cI *, <ins class="diffchange diffchange-inline">the </ins>signal <ins class="diffchange diffchange-inline">produced by </ins>AHL <ins class="diffchange diffchange-inline">will </ins>be short-lived since aiiA is degradating <ins class="diffchange diffchange-inline">it </ins>constantly, so the system quickly returns to its initial state. <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <br /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <strong>Parts </strong><br /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> <strong>Parts </strong><br /></div></td></tr>
</table>Cvargashttp://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=50553&oldid=prevLarriola at 10:33, 2 October 20082008-10-02T10:33:51Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 10:33, 2 October 2008</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><html></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><html></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><head></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><head></div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><title>LCG-UNAM-<del class="diffchange diffchange-inline">MexicoTeam</del></title></div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><title>LCG-UNAM-<ins class="diffchange diffchange-inline">Mexico:Notebook/June_2</ins></title></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><meta http-equiv="Content-Type" content="text/html; charset=utf-8" /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><meta http-equiv="Content-Type" content="text/html; charset=utf-8" /></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><link rel="stylesheet" href="http://mx.geocities.com/apocaliptycmaster/FormatowikiLCG.css" type="text/css" /></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div><link rel="stylesheet" href="http://mx.geocities.com/apocaliptycmaster/FormatowikiLCG.css" type="text/css" /></div></td></tr>
</table>Larriolahttp://2008.igem.org/wiki/index.php?title=Team:LCG-UNAM-Mexico/Notebook/2008-June_2&diff=50547&oldid=prevLarriola: New page: <html> <head> <title>LCG-UNAM-MexicoTeam</title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link rel="stylesheet" href="http://mx.geocities.com/apocaliptycmaste...2008-10-02T10:27:33Z<p>New page: <html> <head> <title>LCG-UNAM-MexicoTeam</title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link rel="stylesheet" href="http://mx.geocities.com/apocaliptycmaste...</p>
<p><b>New page</b></p><div><html><br />
<head><br />
<title>LCG-UNAM-MexicoTeam</title><br />
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" /><br />
<link rel="stylesheet" href="http://mx.geocities.com/apocaliptycmaster/FormatowikiLCG.css" type="text/css" /><br />
<script language="javascript"><br />
<br />
//detecta navegador<br />
browserName = navigator.appName;<br />
browserVer = parseInt(navigator.appVersion);<br />
if (browserName == "Netscape" && browserVer >= 3) browserVer = "1";<br />
else if (browserName == "Microsoft Internet Explorer" && browserVer == 4) browserVer = "1";<br />
else browserVer = "2";<br />
<br />
//precarga imagenes<br />
if (browserVer == 1) {<br />
a1 = new Image(200,40);<br />
a1.src = "https://static.igem.org/mediawiki/igem.org/5/57/BOTON_BACK1.jpg";<br />
a2 = new Image(200,40);<br />
a2.src = "https://static.igem.org/mediawiki/igem.org/2/2a/BOTON_BACK2.jpg";<br />
b1 = new Image(200,40);<br />
b1.src = "https://static.igem.org/mediawiki/igem.org/c/c8/BOTON_Next1.jpg";<br />
b2 = new Image(200,40);<br />
b2.src = "https://static.igem.org/mediawiki/igem.org/1/1d/BOTON_Next2.jpg";<br />
}<br />
<br />
//función de cambio de imagenes<br />
function hiLite(imgDocID, imgObjName, comment) {<br />
if (browserVer == 1) {<br />
document.images[imgDocID].src = eval(imgObjName + ".src");<br />
window.status = comment; return true;<br />
}}<br />
<br />
</script> <br />
<script language="JavaScript" type="text/javascript"><br />
//--------------- Fecha ---------------<br />
var d=new Date();<br />
var monthname=new Array("January","February","March","April","May","June","July","August","September","October","November","December");<br />
var TODAY = monthname[d.getMonth()] + " " + d.getDate() + ", " + d.getFullYear();<br />
//--------------- END Fecha ---------------<br />
</script><br />
</head><br />
<body bgcolor="#F4FFE4"><br />
<table width="82%" border="0" cellspacing="0" cellpadding="0"><br />
<tr bgcolor="#D5EDB3"><br />
<td colspan="3" rowspan="2"><img src="https://static.igem.org/mediawiki/igem.org/b/b3/LCG_copy.png" alt="Header image" width="524" height="143" border="0" /></td><br />
<td height="50" colspan="3" id="logo" valign="bottom" align="center" nowrap="nowrap">LCG-UNAM-Mexico</td><br />
<td width="132" rowspan="2"><img src="https://static.igem.org/mediawiki/2008/1/1d/TeamLogo_00.png" width="120" height="142" /></td><br />
</tr><br />
<br />
<tr bgcolor="#D5EDB3"><br />
<td height="51" colspan="3" id="tagline" valign="top" align="center">iGEM 2008 TEAM</td><br />
</tr><br />
<br />
<tr><br />
<td colspan="7" bgcolor="#5C743D"><img src="https://static.igem.org/mediawiki/2008/7/70/Head_spacer.gif" alt="" width="1" height="2" border="0" /></td><br />
</tr><br />
<br />
<tr><br />
<td colspan="7" bgcolor="#99CC66" background="https://static.igem.org/mediawiki/2008/7/7d/Head_dashed_line.gif"><img src="https://static.igem.org/mediawiki/2008/7/7d/Head_dashed_line.gif" alt="line decor" width="4" height="3" border="0" /></td><br />
</tr><br />
<br />
<tr bgcolor="#99CC66"><br />
<td colspan="7" id="dateformat" height="20">&nbsp;&nbsp;<script language="JavaScript" type="text/javascript"><br />
document.write(TODAY); </script> </td><br />
</tr><br />
<tr><br />
<td colspan="7" bgcolor="#99CC66" background="https://static.igem.org/mediawiki/2008/7/7d/Head_dashed_line.gif"><img src="https://static.igem.org/mediawiki/2008/7/7d/Head_dashed_line.gif" alt="line decor" width="4" height="3" border="0" /></td><br />
</tr><br />
<br />
<tr><br />
<td colspan="7" bgcolor="#5C743D"><img src="https://static.igem.org/mediawiki/2008/7/70/Head_spacer.gif" alt="" width="1" height="2" border="0" /></td><br />
</tr><br />
<br />
<tr><br />
<td width="224" valign="top" bgcolor="#5C743D"><br />
<table border="0" cellspacing="0" cellpadding="0" width="165" id="navigation"><br />
<tr><br />
<td width="165" bgcolor="#5C743D">&nbsp;<br /><br />
&nbsp;<br /></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico" class="navText">Home</a></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Team" class="navText">About Us</a></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Project" class="navText">Our Project</a></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Experiments" class="navText">Experiments</a></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Parts" class="navText">Parts Submitted to the Registry</a></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Modeling" class="navText">Modeling</a></td><br />
</tr><br />
<tr><br />
<td width="165" bgcolor="#5C743D"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Notebook" class="navText">Notebook</a></td><br />
</tr><br />
</table><br />
<br /><br />
&nbsp;<br /><br />
&nbsp;<br /><br />
&nbsp;<br /> </td><br />
<td width="42">&nbsp;</td><br />
<td colspan="4" valign="top"><img src="https://static.igem.org/mediawiki/2008/7/70/Head_spacer.gif" alt="" width="305" height="1" border="0" /><br /><br />
&nbsp;<br /><br />
&nbsp;<br /><br />
<table border="0" cellspacing="0" cellpadding="2" width="590"><br />
<tr><br />
<td class="pageName"><strong>June</strong><p></p></td> <br />
</tr><br />
<tr><br />
</td><br />
</tr><br />
<tr><br />
<td class="subHeader" bgcolor="#99CC66" id="18">2008-06-18</td> <br />
</tr><br />
<tr><br />
<td class="bodyText"><p><strong>Final design</strong></p><br />
<p>Scheme</p><br />
<p><div id="pbfw"><br />
<div id="ub_r"><img src="http://docs.google.com/File?id=dntmktb_46fd48j4fx_b" width="580" alt="" id="ckrm" /></div><br />
</div><br />
<p align="center"><br /></p><br />
<p>The first plasmid contains the efflux pump for Nickel (rcnA), which will maintain its natural regulation dependent of metal (by RcnR) and additionally, it will contain a promoter regulated by the repressor of lambda phage, cI. Besides, of course, a resistance as a marker of the plasmid. </p><br />
<p> <br />
The second contains everything needed for regulating the power down from an external signal (AHL). Both luxR as aiiA will occur constitutively, the first one, with a strong promoter (pTetR), as we do not want the presence of LuxR to be limiting, and the second one, having a moderate promoter or weak (pLacZ), to give us space to play with concentrations of AHL without aiiA always wining. And cI *, cI modified with a queue of LVA for rapid degradation, regulated by a promoter dependent of LuxR + AHL. It will also contain an equal resistance as a marker. </p><br />
<p> <br />
In the presence of AHL, this joins with LuxR and induces the production of cI *, which in turn represses the transcription of rcnA. Like cI *, signal AHL has to be short-lived since aiiA is degradating constantly, so the system quickly returns to its initial state once it ceases to manage AHL. <br /><br />
<br /><br />
<strong>Parts </strong><br /><br />
<br /><br />
Defining bioparts we will use or where to get what is necessary. <br /><br />
<em><br /><br />
<strong>Part: BBa_I729006</strong></em></p><br />
<p><div id="pbfw"><br />
<div id="ub_r"><br />
<div id="w-cp"><img src="http://docs.google.com/File?id=dc5zwbn5_6cfx5c956_b" width="580" alt="" id="yp7t" /> </div><br />
</div><br />
</div><br />
<p align="center"><br /></p><br />
<p>Part of Quorum sensing used by the team Chiba in iGEM2007. Both tetR and LacI + pL are constitutive promoters, but since LacI + pL is a very strong promoter, it will probably be replaced. This biopart will be responsible for the regulation by luxR and the action of the system by AHL. Instead of GFP (Subpart E0040), the BBa_C0051 part that codes for the protein cI + LVA will be inserted, which will join the regulatory region of cI (biopart BBa_R0051) in the other plasmid.</p><br />
<p>(Previous experience: none)</p><br />
<p><strong><em>Part:BBa_C0051</em></strong></p><br />
<p><div id="pbfw"><br />
<div id="ub_r"><br />
<div id="w-cp"><br />
<div id="sebl"><img src="http://docs.google.com/File?id=dc5zwbn5_8hrpddscq_b" alt="" width="580" id="qu3v" /> </div><br />
</div><br />
</div><br />
</div><br />
<p align="center"><br /></p><br />
<p>Region coding for the repressor cI based on the repressor cI of lambda phage with modified LVA with a queue for rapid degradation. cI joins the regulator cI (BBa_R0051)</p><br />
<p>(Previous experience: none)</p><br />
<p><strong><em>Part:BBa_R0051</em></strong></p><br />
<p><div id="dmii"><img src="http://docs.google.com/File?id=dc5zwbn5_7fsbr26rq_b" alt="" width="580" id="zrt-" /></div><br />
<p align="center">&nbsp;<br /><br />
</p><br />
<p>Promoter regulated by cI based on the pR promoter of lambda phage. The promoter has two binding sites to cI repressor of lambda phage (BBa_C0051). The union of cI results in the suppression of the transcript. </p><br />
<p>(Previous experience: it works) <br /><br />
<br /><br />
Of the previous 3 bioparts, the sequence is in the registration of biological parts and according to this page, DNA is available. </p><br />
<p><strong><em> Part: BBa_G00510</em></strong></p><br />
<p> This is the forward primer of C0051 that has 24 pb. <br /><br />
(No DNA in the bank, but we know that it works) <br /><br />
gatttctgcatagccagacttggg </p><br />
<p><strong><em> Part: BBa_G00511 </em></strong></p><br />
<p> Reverse primer for C0051 that has 26 pb. <br /><br />
cactgactagcgataactttccccac <br /><br />
(No DNA in the bank but we know that it works)</p><br />
<p><strong>Vectors</strong></p><br />
<p>We need to define the vectors we can use. </p><br />
<p> Possibilities: <br /><br />
*The ones recorded in the spreadsheet (courses). <br /><br />
<br /><br />
In bioparts:</p><br />
<table width="500" border="2"><br />
<tr><br />
<td width="225"><div align="center"><strong>Name</strong></div></td><br />
<td width="257"><div align="center"><strong>Description</strong></div></td><br />
</tr><br />
<tr><br />
<td><a href="http://partsregistry.org/wiki/index.php?title=Part:pSB3C5">pSB3C5</a></td><br />
<td>Low to medium copy BioBrick standard vector</td><br />
</tr><br />
<tr><br />
<td><a href="http://partsregistry.org/wiki/index.php?title=Part:pSB3T5">pSB3T5</a></td><br />
<td>Low to medium copy BioBrick standard vector</td><br />
</tr><br />
<tr><br />
<td><a href="http://partsregistry.org/wiki/index.php?title=Part:pSB4A3">pSB4A3</a></td><br />
<td>pSB4A3</td><br />
</tr><br />
<tr><br />
<td><a href="http://partsregistry.org/wiki/index.php?title=Part:pSB4C5">pSB4C5</a></td><br />
<td>Low copy BioBrick standard vector</td><br />
</tr><br />
<tr><br />
<td><a href="http://partsregistry.org/wiki/index.php?title=Part:pSB4A1">pSB4A1</a></td><br />
<td>pSB4A1</td><br />
</tr><br />
<tr><br />
<td><a href="http://partsregistry.org/wiki/index.php?title=Part:pSB4A5">pSB4A5</a></td><br />
<td>Low copy BioBrick standard vector</td><br />
</tr><br />
<tr><br />
<td><a href="http://partsregistry.org/wiki/index.php?title=Part:pSB4T5">pSB4T5</a></td><br />
<td>Low copy BioBrick standard vector </td><br />
</tr><br />
<tr><br />
<td><a href="http://partsregistry.org/wiki/index.php?title=Part:BBa_I739202">BBa_I739202</a></td><br />
<td>pCK01BB1</td><br />
</tr><br />
</table><br />
<p><strong>Primers</strong></p><br />
<p> Build or find oligos that we could use for our constructions.</p><br />
<p> We need: <br /><br />
• rcnA (with its regulatory region; no promoter).<br /><br />
• cI *.<br /><br />
• Constitutive promoter for luxR (tetR is proposed, it is a strong promoter). <br /><br />
• Constitutive promoter for aiiA (lacZ is proposed, it is a moderate promoter). <br /><br />
• aiiA.<br /><br />
• Promoter dependent of cI.<br /><br />
~ In all cases, we have to check whether they already exist (in biopartes or something) and evaluate them.</p><br />
<table border="2" cellspacing="0" cellpadding="0" width="500"><br />
<tr><br />
<td width="107" valign="bottom"><p align="center">&nbsp;</p></td><br />
<td width="56" valign="bottom"><p align="center">&nbsp;</p></td><br />
<td width="319" valign="bottom"><p align="center"><strong>Sequence</strong></p></td><br />
<td width="94" valign="bottom"><p align="center"><strong>Tm</strong></p></td><br />
<td width="35" valign="bottom"><p align="center"><strong>Deg.</strong></p></td><br />
<td width="67" valign="bottom"><p align="center"><strong>Restr. S</strong></p></td><br />
<td width="100" valign="bottom"><p align="center"><strong>Bioparts</strong></p></td><br />
</tr><br />
<tr><br />
<td width="107" valign="bottom"><div><br />
<p align="center">(pTetR)luxR/(p. </p><br />
</div></td><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Upper </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">&nbsp;</p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">62.5 ºC</p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">1 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div><br />
<p align="center">None </p><br />
</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">? </p><br />
</div></td><br />
</tr><br />
<tr><br />
<td width="107" valign="bottom"><div><br />
<p align="center">c.fuerte)aiiA </p><br />
</div></td><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Lower </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">&nbsp;</p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">63.8 ºC </p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">1 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div><br />
<p align="center">None</p><br />
</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">? </p><br />
</div></td><br />
</tr><br />
<tr><br />
<td width="107" rowspan="2"><div><br />
<p align="center">pcI </p><br />
</div></td><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Upper </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">&nbsp;</p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">61.9-76.2 ºC </p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">864 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div align="center">None</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">? </p><br />
</div></td><br />
</tr><br />
<tr><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Lower </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">&nbsp;</p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">66.5 ºC </p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">1 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div><br />
<p align="center">None </p><br />
</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">? </p><br />
</div></td><br />
</tr><br />
<tr><br />
<td width="107" rowspan="2"><div><br />
<p align="center">pLacZ </p><br />
</div></td><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Upper </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">5' GCACCCAGGCTTTACACTTT 3' </p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">64.7 ºC </p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">1 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div align="center">None</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">? </p><br />
</div></td><br />
</tr><br />
<tr><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Lower </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">5' TGTTATCCGCTCACAATTCCA 3' </p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">60.3 ºC </p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">1 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div><br />
<p align="center">None</p><br />
</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">? </p><br />
</div></td><br />
</tr><br />
<tr><br />
<td width="107" rowspan="2"><div><br />
<p align="center">cI* </p><br />
</div></td><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Upper </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">5' GATTTCTGCATAGCCAGACTTGGG 3'</p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">62.9 ºC </p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">1 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div align="center">None</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">BBa_G00510 </p><br />
</div></td><br />
</tr><br />
<tr><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Lower </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">5' CACTGACTAGCGATAACTTTCCCCAC 3' </p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">61.9 ºC </p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">1 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div align="center">None</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">BBa_G00511 </p><br />
</div></td><br />
</tr><br />
<tr><br />
<td width="107" rowspan="2"><div><br />
<p align="center">rcnA </p><br />
</div></td><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Upper </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">5' CACTATTAATCTACTGGGGGGTAG3' </p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">64.2ºC </p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">1 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div align="center">None</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">&nbsp;</p><br />
</div></td><br />
</tr><br />
<tr><br />
<td width="56" valign="bottom"><div><br />
<p align="center">Lower </p><br />
</div></td><br />
<td width="319" valign="bottom"><div><br />
<p align="center">5' AGTTATCGCATTATGCCCATG 3' </p><br />
</div></td><br />
<td width="94" valign="bottom"><div><br />
<p align="center">65.8ºC</p><br />
</div></td><br />
<td width="35" valign="bottom"><div><br />
<p align="center">1 </p><br />
</div></td><br />
<td width="67" valign="bottom"><div align="center">None</div></td><br />
<td width="100" valign="bottom"><div><br />
<p align="center">&nbsp;</p><br />
</div></td><br />
</tr><br />
</table><br />
<p><strong>Promoters</strong></p><br />
<p>Investigate a little more about the proposed promoters and define whether they are the most optimal.</p><br />
<table border="2" cellspacing="0" cellpadding="0" width="580"><br />
<tr><br />
<td width="74" valign="bottom"><p align="center"><strong>Promoter</strong></p></td><br />
<td width="129" valign="bottom"><p align="center"><strong>Biopart</strong></p></td><br />
<td width="215" valign="bottom"><p align="center"><strong>Constitutive</strong>?</p></td><br />
<td width="135" valign="bottom"><p align="center"><strong>Strength </strong></p></td><br />
<td width="246" valign="bottom"><p align="center"><strong>Notes</strong></p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">pTetR </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_R0040 </p></td><br />
<td width="215" valign="bottom"><p align="center">In tetracycline presence or TetR absence</p></td><br />
<td width="135" valign="bottom"><p align="center">medium</p></td><br />
<td width="246" valign="bottom"><p align="center">Recomended by our advisor Miguel</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">pLuxR-HSL </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_R0062 </p></td><br />
<td width="215" valign="bottom"><p align="center">Over-regulated by LuxR-HSL (increases its expression). </p></td><br />
<td width="135" valign="bottom"><p align="center">weak (constitutive)/medium (LuxR-HSL) </p></td><br />
<td width="246" valign="bottom"><p align="center"> luxR could bring some trouble if it becomes a part of the sistem</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">pLacIQ </p></td><br />
<td width="129" valign="bottom"><p align="center">BBA_I14032</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">high</p></td><br />
<td width="246" valign="bottom"><p align="center">¿Is there a biopart? It could be the promoter for luxR</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">pCyc </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_I766555 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes </p></td><br />
<td width="135" valign="bottom"><p align="center">medium</p></td><br />
<td width="246" valign="bottom"><p align="center">Yeast promoter</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23112 </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">1 </p></td><br />
<td width="246" valign="bottom"><p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23103 </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">17 </p></td><br />
<td width="246"><p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23113 </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">21 </p></td><br />
<td width="246"><p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23109 </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">106</p></td><br />
<td width="246"><p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23117</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">162</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23114</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">256</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23115</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">387</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23116</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">396</p></td><br />
<td width="246" rowspan="2" valign="bottom"><p align="center">Constitutive promoters family</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23105</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">62</p></td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23110</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">844</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23107</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">908</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23106</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">1185</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23108</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">1303</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23118</p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113</p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">1429</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23111 </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">1487</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23101 </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">1791</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23104 </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">1831</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23102 </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">2179</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="74" valign="bottom"><p align="center">J23100 </p></td><br />
<td width="129" valign="bottom"><p align="center">BBa_J23113 </p></td><br />
<td width="215" valign="bottom"><p align="center">Yes</p></td><br />
<td width="135" valign="bottom"><p align="center">2547</p></td><br />
<td width="246">&nbsp;</td><br />
</tr><br />
</table><br />
<p><strong>Facts about kinetics &amp; other things...</strong></p><br />
<p> <br />
Investigate a little more about the parties involved in the system to begin with an outline of modeling and defining how the design is theoretically feasible. <br /><br />
<br /><br />
<em>Note: </em>To join HSLwith LuxR and enable the transcription of cI, HLS should be at a concentration of micromolar order.<br /><br />
<em>Note (2)</em>: Not all bioparts have been used previously, most DNA is available but still there is no record of it working. We need to check the quality of DNA to ensure that there will be no problems.</p><br />
</tr> <br />
<tr><br />
<td class="subHeader" bgcolor="#99CC66" id="24">2008-06-24</td> <br />
</tr><br />
<tr><br />
<td class="bodyText"><p align="center"><strong>Modeling</strong><br><br />
<strong id="j4px695"><img src="http://docs.google.com/File?id=dntmktb_59hmv4brc3_b" alt="" name="graphics3" width="255" height="289" hspace="13" border="0" align="left" id="j4px696" /></strong><br><strong>Variables</strong> <br><br />
Concentrations of:</p><br />
<ul><br />
<li>LuxR (constant). </li><br />
<li>aiiA (constant). </li><br />
<li>AHL (arbitrary). </li><br />
<li>cI* (according to aiiA, AHL &amp; LuxR). </li><br />
<li>RcnA (according to cI*). </li><br />
</ul><br />
<p>Knowing the initial concentrations and lifetime of proteins involved, as well as the efficiency action of aiiA (kinetics in general). <br /><br />
* The concentration of Nickel (NiCl2) in the medium which supports the cell according to Rodrigue et al. (2005) before inhibiting growth is 4 μ M for the strain lacking rcnA, 10 μ M in the wildtype and up to 100 times more in a strain with a multicopy gene.</p><br /><br /><br /><br />
<p>&nbsp;</p><br />
<table border="0" cellspacing="0" cellpadding="0"><br />
<tr><br />
<td width="50" height="40" valign="bottom"><p align="center">&nbsp;</p></td><br />
<td width="149" valign="bottom"><p align="center"><strong>Concentration</strong></p></td><br />
<td width="147" valign="bottom"><p align="center"><strong>Life span (half-life)</strong></p></td><br />
<td width="155" valign="bottom"><p align="center"><strong>Substrate affinity</strong></p></td><br />
<td width="159" valign="bottom"><p align="center"><strong>Notes</strong></p></td><br />
</tr><br />
<tr><br />
<td width="50" valign="bottom"><p align="center"><strong>AHL</strong></p></td><br />
<td width="149" valign="bottom"><p align="center">?</p></td><br />
<td width="147" valign="bottom"><p align="center">3 hrs.</p></td><br />
<td width="155" valign="bottom"><p align="center">?</p></td><br />
<td width="159" valign="bottom"><p align="center">Conflictive information</p></td><br />
</tr><br />
<tr><br />
<td width="50" rowspan="2"><p align="center"><strong>LuxR</strong></p></td><br />
<td width="149" rowspan="2"><p align="center">?</p></td><br />
<td width="147" valign="bottom"><p align="center">60 min- (~40-100)</p></td><br />
<td width="155" rowspan="2"><p align="center">?</p></td><br />
<td width="159" valign="bottom"><p align="center">&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td width="147" valign="bottom"><p align="center">2 min (35 min +AHL)</p></td><br />
<td width="159" valign="bottom"><p align="center">&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td width="50" valign="bottom"><p align="center"><strong>aiiA</strong></p></td><br />
<td width="149" valign="bottom"><p align="center">?</p></td><br />
<td width="147" valign="bottom"><p align="center">24 hrs</p></td><br />
<td width="155" valign="bottom"><p align="center">?</p></td><br />
<td width="159" valign="bottom"><p align="center">&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td width="50" valign="bottom"><p align="center"><strong>cI*</strong></p></td><br />
<td width="149" valign="bottom"><p align="center">?</p></td><br />
<td width="147" valign="bottom"><p align="center">?</p></td><br />
<td width="155" valign="bottom"><p align="center">?</p></td><br />
<td width="159" valign="bottom"><p align="center">&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td width="50" valign="bottom"><p align="center"><strong>RcnA</strong></p></td><br />
<td width="149" valign="bottom"><p align="center">?</p></td><br />
<td width="147" valign="bottom"><p align="center">?</p></td><br />
<td width="155" valign="bottom"><p align="center">?</p></td><br />
<td width="159" valign="bottom"><p align="center">&nbsp;</p></td><br />
</tr><br />
</table><br />
<p><em>Assumption 1:</em> Once there is nickel in the medium, RcnR does not matter for the pump regulation. This because there will be large concentrations of metal, so we can assume that RcnR will always be linked to a molecule and it will therefore be unable to suppress the transcript of rcnA; the noise that the few RcnR free molecules can cause, will be indistinguishable from normal behaviour of the pump. <br /><br />
</p><br />
<p><em>Assumption 2:</em> Any decrease in the concentration of AHL is due to aiiA. It is believed that the natural degradation of this is irrelevant in the time scale analysis. Either way, a process will not be distinguishable from the other and even when the first is estimated, it would not be very informative for the analysis, so we intend to take this assumption as true. <br /><br />
</p><br />
<p><em>Assumption 3:</em> The transcription of cI * depends solely on the concentration of AHL. LuxR is not a limiting step, ie, it is in constant concentration and in sufficient quantity to be always available to associate with AHL. Only to simplify the analysis, at least as a first approximation.</p><br />
<p><strong>Initial outline:</strong></p><br />
<p>(v1) AHL0 <br /><br />
(v2) aiiA + AHL -&gt; aiiA <br /><br />
(v3) AHL + LuxR -&gt; cI* <br /><br />
(v4,v5) ρ + cI* &lt;--&gt; ρ.cI* <br /><br />
ρ -&gt; ρ +RcnA <br /><br />
RcnA + Ni -&gt; RcnA <br /><br />
RcnA -&gt; Ø </p><br />
<p align="center">&nbsp;</p><br />
</td><br />
</tr> <br />
<tr><br />
<td class="subHeader" bgcolor="#99CC66" id="26">2008-06-26</td> <br />
</tr><br />
<tr><br />
<td class="bodyText"><p><p><strong>Experimental work</strong></p><br />
<p>&nbsp;</p><br />
<p>1. Take the sequences (fasta format) <br /><br />
2. Once you have the sequence find appropriate reading frames <br /><br />
3. Make the restriction map<br /><br />
-- Nedcutter, check the page for NewEngland Biolabs (because we are going to use enzymes from that company) <br /><br />
For rcnA and rcnR, the regulatory region that was among the two genes was not explained. <br /><br />
We have to take the whole sequence in fasta format and use it in a program called Gene Construction Kit. This shows reading frames and restriction sites. </p><br />
<p>&nbsp;</p><br />
<p>In fruitfly.org: 9005/seq_tools/promoter.html we can look for primers and we can adjust parameters. We can also analyze the stability energy, and seek the lowest point of stability. This point is generally the -10box. To find inverted repeats, we shall use the program StemLoop of the parcel of GCG (genetics computer group). This program calls in the sequence in a GCG format. To find direct repeats we will use the program &quot;repeat&quot;. For rcnR and rcnA we found three direct repeats between the -10 box and the translation start of rcnA.We suggest that this is a regulatory region. Based on this, we designed the primers, trying to preserve the regulatory region and changing its promoter.</p><br />
<p>&nbsp;</p><br />
<p><em>Primer design.</em> The region should be rich in GC, of about 20 nucleotides with a 50% GC content at least and it should finish in G. The program can also show the double chain to facilitate the design of oligo lower. If they are rich in AT, they can be longer primers to increase its Tm. </p><br />
<p>&nbsp;</p><br />
<p>The most popular program at the center is Oligo. Here we open a new window and paste the sequence. This will open two windows. The first one with the Tm, and the other one with the free energy. The program can calculate all oligos and show potential couples with its parameters. We can also specify were we want the oligo to be located. Once the program generates it, we can analyze its biochemical properties. </p><br />
<p><em>Trying to k Delta G so it won't be lower than -10. </em></p><br />
<p><br /><br />
The differences between the TMS should not be greater than 5 degrees. Enzymes used in PCR use magnesium chloride. The most reliable and processed use magnesium acetate. It is said that 10mM of dinucleotidos is an optimal concentration for PCR, .4 mM is used in the lab. Once we have the oligo, we add a site at the far restraining 5 '. And add nucleotides in the 5 'end to ensure that the enzyme is positioned correctly and efficiently cut. These nucleotides are different for each enzyme, and they also protect the 5' end. </p><br />
<p>&nbsp;</p><br />
<p>Two plasmids are used as a basis prK415 P. Our advisor, Miguel, already has isolated DNA and this DNA will be used to transform and to have a the plasmid reserved. 2ul of the plasmid and competent cells treated with calcium chloride. The theory says that positive ions are attached to the membrane, so the membrane has a positive charge. As DNA has a negative charge, once they are mixed at 4 degrees Celsius for 20 minutes, we are going to take the tube and put it at 42 degrees centigrade. This stress produces holes in the membrane and many things will be capable or entering or exiting through the membrane, including DNA. Then it remains 2 more minutes at this temperature. The we return it to ice for 5 more minutes to recover. Later, the cells are placed in 1ml of rich medium (LB) were they are allowed to grow at 37 degrees for one hour at 300 revolutions per minute (this allows them to recover).</p><br />
<p>&nbsp; </p><br />
<p>100ul are taken and used to plate in petri dishes with the antibiotic. It is left to grow for an entire day and at the end, isolated colonies should appear.<br /><br />
Bacteria with kanamycin 5ml of two strains, one with a deletion in rcnA and another one with any deletion except for rcnA . For 6 hours, the bacteria will have an exponential growth. Genomic DNA will be extracted. </p><br />
<p>&nbsp;</p><br />
<p>The contents of the tube will be put in an eppendorf, we centrifuge and then we withdraw the liquid medium with a syringe. Before we lyse de cells, we need to wash with TE 10 1 (Tris 10uM EDTA 1uM), with pH 8. Vortex, to separate and disintegrate. Again, we centrifuge and remove supernatant. To lyse, we add 400-450 ul TE5020pH8 and SDS 10% and K proteinase. We leave it at 37 degrees for 20 minutes. The medium goes from an opaque color to a light color when lysis happens. We add ethanol 100% once we have lysed the cells and we vortex. In the presence of ethanol DNA is precipitated, so we add 1ml of ethanol. Then we centrifuge for a few minutes and we have pellet. We wash three times with ethanol 70%, which solubilised salts and the small molecules (including RNA). We remove all the ethanol, this tube is placed in a specific centrifuge. The vacuum from this centrifuge will remove the remain solvent. It is necessary to remove all the ethanol, because this affects the pH. TE 10 1 RNAs 10mg per ml, this Stock solution is divided 1000 times and 50ul approx are added. To check the quality of the DNA extracted, we use an agarose gel.</p><br />
<p>&nbsp;</p><br />
<p><em>Transforming bioparts: </em>Bacteria needed to extract DNA plasmid. Centrifuge, wash and put solution 1. Glucose, TRIS, EDTA and sometimes RNAs 1. Sodium hydroxide and SDS in the solution 2, sodium hydroxide denatures the DNA. Solution 3 with sodium acetate neutralizes the base. Wash and dry every time.</p></p><br />
</td><br />
</tr> <br />
<tr><br />
<td colspan="6"><br />
<p align="center"><a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Notebook/2008-June" onMouseOver="hiLite ('Back','a2','Back')" onMouseOut="hiLite('Back','a1','')"> <img name="Back" src="https://static.igem.org/mediawiki/igem.org/5/57/BOTON_BACK1.jpg" border=0 width="200" height="40"/></a><br />
<br />
<a href="https://2008.igem.org/Team:LCG-UNAM-Mexico/Notebook/2008-July" onMouseOver="hiLite ('Next','b2','Next')" onMouseOut="hiLite('Next','b1','')"> <img name="Next" src="https://static.igem.org/mediawiki/igem.org/c/c8/BOTON_Next1.jpg" border=0 width="200" height="40"/></a></p><br />
</td><br />
</tr> <br />
</td><br />
</tr><br />
</table><br /><br />
&nbsp;<br /><br />
<td width="132">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="224">&nbsp;</td><br />
<td width="42">&nbsp;</td><br />
<td width="296">&nbsp;</td><br />
<td width="135">&nbsp;</td><br />
<td width="59">&nbsp;</td><br />
<td width="109">&nbsp;</td><br />
<td width="132">&nbsp;</td><br />
</tr><br />
</table><br />
</body><br />
</html></div>Larriola