Team:University of Washington/Protocols
From 2008.igem.org
(→Conjugation method #1(Bac-Bac)) |
(→Conjugation method #1(Bac-Yeast)) |
||
Line 184: | Line 184: | ||
1. Grow overnight cultures of donor and recipient cells<br\> | 1. Grow overnight cultures of donor and recipient cells<br\> | ||
- | 2. Add | + | 2. Add 50uL of donor cells and 50uL of recipient cells into 4mL of nutrient rich broth<br\> |
·rotate for 4 hours<br\> | ·rotate for 4 hours<br\> | ||
- | 3. Plate out | + | 3. Plate out 10uL of donor/recipient culture on a selection plate. |
== Conjugation method #2(Bac-Yeast) == | == Conjugation method #2(Bac-Yeast) == |
Revision as of 18:29, 10 July 2008
Contents |
Electrocompetent Cells (One Sample)
This is for making one/two aliquots of electrocompetent cells
1. Grow overnight culture of your cells
2. Back-dilute 1:50 into 3 mLs (so 60 uL), put on rotator in 37 degree incubator for 3 hours (put water on ice during this time)
3. Pellet in epi tube, top speed for ~20-30 sec
4. Remove supernatant. Wash cells 3X in cold water 1 mL each.
5. Resuspend in 40 uL cold water, add DNA, electroporate
Glycerol Stocks
For the long-term storage of microbial cultures
Make sure that you do not contaminate glycerol stocks
1. Grow overnight culture (1 mL) of your cells in selective media
2. Mix 750 uL of your culture with 750 uL of 40% glycerol. Immediately place at -80 C (glycerol is toxic to cells and prolonged exposure to it kills them at RT).
If you need to take from the stocks, do not thaw - just scrape some ice off of the top with a sterile loop and smear across a plate.
Lambda Red Recombination
This is for site-directed mutagenesis of chromosomes or large plasmids
1. Amplify antibiotic resistance cassette with primers that are homologous to cassette and your region of interest.
- For Kan:
- Primer F: 5' 40 bp your sequence + GTGTAGGCTGGAGCTGCTTC - 3' (Tm = 64C)
- Primer R: 5' 40 bp your sequence + CATATGAATATCCTCCTTAG - 3' (Tm = 54C)
- For Tet:
- Primer F: 5' 40 bp your sequence + TTAAGAACCCACTTTCACA - 3'
- Primer R: 5' 40 bp your sequence + CTAAGCACTTGTCTCCTG - 3'
- Set up your PCR as follows:
-5 uL 10X polymerase buffer
-4 uL dNTPs at 10 mM
-2.5 uL DMSO (ONLY IF USING PFU)
-2.5 uL primer F (1:10 dilution of 100 uM)
-2.5 uL primer R (1:10 dilution of 100 uM)
-2 uL plasmid template
-1 uL polymerase (taq or PFU)
-33 uL dH20 for taq, or 30.5 uL dH2O for PFU
Segment | Cycles | Temperature | Time |
---|---|---|---|
1 | 1 | 95°C | 1 minute |
2 | 30 | 95°C | 1 minute |
45°C | 1 minute | ||
72°C | 2 minutes | ||
3 | 1 | 72°C | 10 minutes |
4 | 1 | 4°C | HOLD |
2. Run small aliquot on gel to verify.
3. Qiagen PCR purification kit, elute with water.
4. Transform 15 uL into cells that express lambda red machinery
- If these cells have machinery on pKD46 plasmid: Grow O/N culture at 30C, Sub 1:100 in LB Amp100 + 0.2% arabinose, grow at 30C until OD600 is around 0.6 to 0.8 (25mLs). Wash 2X in cold water (25 mLs, spin 7' at 7K RPM), resuspend in water (100 uL) at density high enough for electroporation.
5. Recover with SOC, plate all on selective media.
6. Streak for isolation
7. Confirm by PCR
Mini Preps
Qiagen Kit
1. 250μL P1 resuspend pellet
2. 250μL P2
3. 350μL N3
4. Centrifuge full speed 10 min.
5. Decant supernatant into filter cartridge
6. Spin 1 min.
·empty collection tube
7. Add 750μL PE wash buffer
8. Spin 1 min.
·empty collection tube
9. Dry spin 2 min.
10. Put filter cartridge in clean eppendorf tube
11. Add 50μL EB
·Centrifuge 2 min. @ 9000 rpm
QuikChange Mutagenesis
Reference: Stratagene QuikChange® XL Site-Directed Mutagenesis Kit Instruction Manual
Prep:
- Design the sequences
- Design primers(>= 40% GC, boiling point >= 78C, length ~25-45 bp, mutation between 10-15 correct bases of sequence, terminate in G or C)
1. Add followings to the thin-walled tube for thermocycling
- 5 μl 10× reaction buffer
- X μl (10 ng) dsDNA template
- X μl (125 ng) oligonucleotide primer #1
- X μl (125 ng) oligonucleotide primer #2
- 1 μl dNTP mix
- 3 μl DMSO
2. Add ddH2O to a final volume of 50 μl
3. Add 1 μl of PfuTurbo DNA polymerase (2.5 U/μl)
4. Do temperature cycling.
Segment | Cycles | Temperature | Time |
---|---|---|---|
1 | 1 | 95°C | 1 minute |
2 | 18 | 95°C | 50 seconds |
60°C | 50 seconds | ||
68°C | 1 minute/kb of plasmid length | ||
3 | 1 | 68°C | 7 minutes |
5. Cool on ice ~2 mins
6. Add 1 μl Dpn1(10 U/μl)
7. Mix solution using a pipet several times, Spin in a Microcentrifuge for 1 min
8. Incubate the reactions at 37°C for 1 hour
Post:
- PRC purification
- Transformation
Sequencing
From medium- or high-copy miniprepped plasmid DNA obtained via Qiagen kit
1. Dilute primer to 1 pmole/uL (=1 umole/mL)
2. Aliquot 8 uL of primer (=8 pmole) per epi tube for each sequencing reaction (1 primer/tube, so if you are doing forward and reverse reaction, two tubes). Make sure that you use the correct primers for your reaction.
3. Add 4 uL Qiagen-miniprepped plasmid DNA
4. Fill out form on UW DNA Sequencing Facility website. Make sure that you are connected to a printer for this. Use budget number: 75-1064, Box number: 355761. If you do not already have an account, you will have to make one. Use your own phone number, and Herbert's info for PI information (Box 355061, William H. Foege Building, Room N210E). Select "Plasmid DNA", give short description to each tube. Write down the number they give you (usually your initials and then some number) on the top of the epindorf tube. At the bottom, select "Rxn and analysis" and "BDSF's Choice", and NO for printing.
5. Print out two copies of the form, one on colored paper (or on white paper that you can then scribble around the edges with a highlighter or a Sharpie). Give the other copy to Ingrid.
6. Submit to sequencing on the 2nd floor of the Hitchcock building. Turn in the colored form where it says "Drop off". Place your samples in the fridge that says "Rxn and analysis", anywhere in a box that says "Template and primer mix".
Conjugation method #1(Bac-Bac)
1. Grow overnight cultures of donor and recipient cells
2. Add 50uL of donor cells and 50uL of recipient cells into 4mL of nutrient rich broth
·rotate for 4 hours
3. Plate out 10uL of donor/recipient culture on a selection plate.
Conjugation method #2(Bac-Bac)
(This is taken from the Bates/Cashmore/Wilkins paper)
1. Grow donor and recipient bacteria at 37°C for three mass doublings to about 2 × 10^8 organisms per ml.
2. Mix 0.5ml of each culture and collect on a cellulose-acetate filter (Sartorius; 0.45-µm pore size; 25-mm diameter)
3. Incubate for 1 h at 37°C on prewarmed nutrient agar.
4. Resuspend cells by vigorously agitating and plate at appropriate dilutions on media selective for transconjugants.
Conjugation method #1(Bac-Yeast)
1. Grow overnight cultures of donor and recipient cells
2. Add 50uL of donor cells and 50uL of recipient cells into 4mL of nutrient rich broth
·rotate for 4 hours
3. Plate out 10uL of donor/recipient culture on a selection plate.
Conjugation method #2(Bac-Yeast)
(This is taken from the Bates/Cashmore/Wilkins paper)
1. Grow donor bacteria and recipient yeast at 30°C for three mass doublings resuspend at a dilution of about 2 × 10^8 organisms per ml.
2. Mix 0.5ml of each culture and collect on a cellulose-acetate filter (Sartorius; 0.45-µm pore size; 25-mm diameter)
3. Incubate for 1 h at 30°C on prewarmed nutrient agar.
4. Resuspend cells by vigorously agitating and plate at appropriate dilutions on media selective for transconjugants.
Double antibiotic plate
·add 20ul of the secondary antibiotic to a plate with the first antibiotic, and spread with a glass rod.
Team:University_of_Washington/Project