"

 

From 2008.igem.org

You do not have permission to edit this page, for the following reason:

You can view and copy the source of this page:

{{Paris/Calendar_Links|August 7|August 9}} == Minipreps : Plasmid extraction== Extraction of '''pSB3K3 et E0240 in pSB1A2 plasmid''' from overnight bacteria culture using the QIAspin Miniprep Kit (QIAGEN) by QIACube. * Carried out 2 times (2 tubes) * {| border="1" |'''name''' |'''Biobrick''' |'''plasmid''' |- |align="center"|MP142 | - |align="center"|pSB3K3 |- |align="center"|MP143 |align="center"|E0240 |align="center"|pSB1A2 |} <br> == '''Amplification of Genes of interest (OmpR, EnvZ, FlhDC)'''== ''We performed PCR on to amplify the sequence in order to have enough amount of DNA to carry out the following of our experiments.'' === '''PCR amplification''' === ==== '''Protocol''' ==== * '''List of Oligos''' : {| |- style="background: #649CD7;" |- style="background: #649CD7; text-align: center;" |width=5%| Number |width=15%| Name |width=40%| Sequence |width=5%| Length |width=30%| Comments |- style="background: #dddddd;" | style="background: #D4E2EF;" | O126 | Gene-EnvZ-F | GTTTCTTCGAATTCGCGGCCGCTTCTAGATGAGGCGATTGCGCTTCTCGCCAC | 53 | |- style="background: #dddddd;" | style="background: #D4E2EF;" | O127 | Gene-EnvZ-R | GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTACCCTTCTTTTGTCGTGCCCTGCGCC | 59 | |- style="background: #dddddd;" | style="background: #D4E2EF;" | O131 | Gene-FlhC-R | GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTAAACAGCCTGTACTCTCTGTTCATCC | 59 | |- style="background: #dddddd;" | style="background: #D4E2EF;" | O132 | Gene-FlhD-F | GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCATACCTCCGAGTTGCTGAAAC | 53 |Don't amplify the natural rbs of FlhD |- style="background: #dddddd;" | style="background: #D4E2EF;" | O138 | Gene-OmpR-F | GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCAAGAGAACTACAAGATTCTGG | 53 | |- style="background: #dddddd;" | style="background: #D4E2EF;" | O139 | Gene-OmpR-R | GTTTCTTCGAATTCGCGGCCGCTTCTAGTTATTATGCTTTAGAGCCGTCCGGTACAAAG | 59 | |} * '''Preparation of the templates''' :<br>Resuspend of 1 colony in 100µl of water. * '''Preparation of PCR mix''' : ''For each samples,'' 1 µl dNTP <br>10 µl Buffer Phusion 5x <br>2,5 µl Oligo_F <br>2,5 µl Oligo_R <br>1µl template <br>1 µl Phusion <br>50 µl qsp H2O (33µl) * {| border="1" |- style="text-align: center;" |'''Name''' |'''genes''' |'''Oligo''' |'''templates''' |- style="text-align: center;" |PCR_127 |FlhDC |O131_O132 |MG1655 |- style="text-align: center;" |PCR_128 |OmpR |O138_O139 |Strain OmpR* |- style="text-align: center;" |PCR_129 |EnvZ |O126_O127 |Strain EnvZ* |- style="text-align: center;" |PCR_Control - | - |O126_O127 |Water |} * Program PCR_Screening : Annealing 55°C - Time élongation 1'30" - Number cycle : 29 ==== '''PCR verification/Analysis''' ==== [[Image:KR000129.jpg‎|thumb|Analysis of PCR product]] ''After the PCR :'' * 3µl have been analysed by electrophoresis * the other 47µl of PCR products have been purified by the Promega kit. * '''Electrophoresis''' ladder : 10µl ladder 1 kb <br> samples : 3µl of PCR products + 2µl of Loading Dye <br> migration 30min at 100W, on a '''1%''' agarose gel * '''Results :''' {| border="1" |- style="text-align: center;" |'''Name''' |'''Promotor''' |align="center"|'''Band''' |align="center"|'''Expected size''' |align="center"|'''Measured size''' |- style="text-align: center;" |PCR_Control - |control - |2 | 0 pb |style="background: #cbff7B"|<center> 0 pb</center> |- style="text-align: center;" |PCR_127 |FlhDC gene |3 |972 pb |style="background: #ff6d73"|<center> 0 pb</center> |- style="text-align: center;" |PCR_128 |OmpR gene |5 |762 pb |style="background: #cbff7B"|<center> 700 pb</center> |- style="text-align: center;" |PCR_129 |EnvZ gene |4 |1421 pb |style="background: #cbff7B"|<center> 1400 pb</center> |} ==> '''Conclusion :''' we observed the size expected for the PCR products, but not for FlhDC gene.<br> We hypothesis that its value of amplification for this gene it's low as we can't visualize it. So we try to continue to experiments to know if there is something inside or not this tube. * '''Quantification of the PCR products purified''' Blank : 2µl of buffer EB + 98µl of water <br>Samples : 2µl of PCR purified + 98µl of water. * '''Results :''' {| border="1" |- style="text-align: center;" |'''Name''' |'''Genes''' |'''C° (µg/ml)''' |'''DO 260/280''' |- style="text-align: center;" |PCR_127 |FlhDC |350 |1.68 |- style="text-align: center;" |PCR_128 |OmpR |150 |1.97 |- style="text-align: center;" |PCR_129 |EnvZ |100 |1.77 |- style="text-align: center;" |MP 108 cl2 (23 july) | -vector- |150 |1.84 |} === Digestion of PCR products === ==== Protocol : ==== {| border="1" |- style="text-align: center;" |'''Name''' |'''Genes''' |'''Water''' |'''DNA''' |'''Buffer n°2 10X''' |'''BSA 100X''' |'''EcoRI''' |'''PstI''' |- style="text-align: center;" |D139 |FlhDC |23.7µl |1µl |3.0µl |0.30µl |1µl |1µl |- style="text-align: center;" |D140 |OmpR |22.7µl |2µl |3.0µl |0.30µl |1µl |1µl |- style="text-align: center;" |D141 |EnvZ |21.2µl |3.5µl |3.0µl |0.30µl |1µl |1µl |- style="text-align: center;" |D142 | -vector- |22.7µl |2µl |3.0µl |0.30µl |1µl |1µl |} * Incubate 2h30 at 37°C ==== Analysis by electrophoresis ==== [[Image:KR000142.jpg‎|thumb|Analysis of PCR product digestion]] * '''Conditions''' ladder : 10µl ladder 1 kb <br>samples : 3µl of insert + 2µl of Loading Dye <br> migration 30min at 100W, on a '''1%''' agarose gel. * '''Results :''' {| border="1" |- style="text-align: center;" |'''Name''' |'''Promotor''' |align="center"|'''Band''' |align="center"|'''Expected size''' |align="center"|'''Measured size''' |- style="text-align: center;" |D139 |FlhDC gene |4 |972 pb |style="background: #ff6d73"|<center> 0 pb</center> |- style="text-align: center;" |D140 |OmpR gene |5 |762 pb |style="background: #cbff7B"|<center> 700 pb</center> |- style="text-align: center;" |D141 |EnvZ gene |6 |1421 pb |style="background: #cbff7B"|<center> 1000 pb</center> |- style="text-align: center;" |D142 | -vector digested- |7 |2057 & 707 pb |style="background: #cbff7B"|<center> 2000 & 700 pb</center> |- style="text-align: center;" |D142 | -vector not digested- |8 |2764 pb |style="background: #cbff7B"|<center> 2100 pb</center> |} ==> '''Conclusions : We validate the digestion of the vector and the insert'''. Now we can be sure, that we detect anything for '''FlhDC genes'''. == '''Transformation with promotors of interest'''== === '''Results''' === {| border="1" |align="center"|'''Name''' |align="center"|'''Description''' |align="center"|'''Antibio''' |align="center"|'''Number of colonies''' |align="center"|'''Number of red fluorescent colonies''' |- |colspan="5"|'''Ligation ''' |- |align="center"|L128 |align="center"|J61002-pFlgA<br>D136 (FV) - D132 (FI) |align="center"|Amp |align="center"|~ 400 |align="center"|2 |- |align="center"|L129 |align="center"|J61002-pFlgB<br>D136 (FV) - D133 (FI) |align="center"|Amp |align="center"|39 |align="center"|5 |- |align="center"|L130 |align="center"|J61002-pFlhB<br>D136 (FV) - D134 (FI) |align="center"|Amp |align="center"|~ 1000 |align="center"|4 (but 3 are on the edge of the petri dishe) |- |align="center"|L131 |align="center"|J61002-pFlhDC<br>D136 (FV) - D135 (FI) |align="center"|Amp |align="center"|39 |align="center"|38 |- |colspan="5"|'''Control ''' |- |align="center"|Control 1 |align="center"|D136 |align="center"|Amp |align="center"|0 |align="center"|0 |- |align="center"|Positive control |align="center"|pUC19 |align="center"|Amp |align="center"|36 |align="center"|0 |} === '''PCR Screening of Ligation Transformants'''=== ''Use of 8 clones of Ligation transformants for PCR screening'' {|| Border="1" |align="center"|'''Ligation''' | colspan="8" align="center"|L128 | colspan="8" align="center"|L129 | colspan="8" align="center"|L130 | colspan="8" align="center"|L131 |- |align="center"|'''Name''' | colspan="8" align="center"|pFlgA | colspan="8" align="center"|pFlgB | colspan="8" align="center"|pFlhB | colspan="8" align="center"|pFlhDC |- |align="center"|'''n° clone''' |align="center"|1 |align="center"|2 |align="center"|3 |align="center"|4 |align="center"|5 |align="center"|6 |align="center"|7 |align="center"|8 |align="center"|1 |align="center"|2 |align="center"|3 |align="center"|4 |align="center"|5 |align="center"|6 |align="center"|7 |align="center"|8 |align="center"|1 |align="center"|2 |align="center"|3 |align="center"|4 |align="center"|5 |align="center"|6 |align="center"|7 |align="center"|8 |align="center"|1 |align="center"|2 |align="center"|3 |align="center"|4 |align="center"|5 |align="center"|6 |align="center"|7 |align="center"|8 |- |align="center"|'''fluorescence''' |align="center"|red |align="center"|red |align="center"|no |align="center"|no |align="center"|no |align="center"|no |align="center"|no |align="center"|no |align="center"|red |align="center"|red |align="center"|red |align="center"|red |align="center"|red |align="center"|no |align="center"|no |align="center"|no |align="center"|red |align="center"|no |align="center"|no |align="center"|no |align="center"|no |align="center"|no |align="center"|no |align="center"|no |align="center"|red |align="center"|red |align="center"|red |align="center"|red |align="center"|red |align="center"|red |align="center"|red |align="center"|no |} ====Protocol of screening PCR==== * '''Mix''' 25µl of Quick Load 2X <br>1µl of forward primer 10µM <br>1µl of reverse primer 10µM <br>23µl of water *'''primers used''' {| Border="1" |align="center"|'''Ligation''' |align="center"|'''Name''' |align="center"|'''primers''' |- |align="center"|L128 |align="center"|pFlgA |align="center"|O100 & O101 |- |align="center"|L129 |align="center"|pFlgB |align="center"|O102 & O 103 |- |align="center"|L130 |align="center"|pFlhB |align="center"|O108 & O 109 |- |align="center"|L131 |align="center"|pFlhDC |align="center"|O111 & O 113 |- |} * 50µl of PCR Mix by tube/clone * one toothpick of each clone's colony per tube * Program : Annealing 55°C - Time élongation 1'30" - Number cycle : 29 * '''Conditions of electrophoresis ''' 10µl of ladder 100 pb <br>10µl of screening PCR <br>migration ~30min at 100W on '''1,5%''' gel ===='''Results of electrophoresis'''==== <br>gel 1 [[Image:KR000143.jpg‎ | gel 1|200px]] gel 2 [[Image:KR000145.jpg|gel 2|200px]] {|- border="1" |align="center"|'''Name''' |align="center"|'''Promotor''' |align="center"|'''Gel''' |align="center"|'''Band''' |align="center"|'''Expected size''' |align="center"|'''Measured size''' |- |align="center"|PCR_124' |align="center"|pFlgA |align="center"|1 |align="center"|2 to 9 |align="center"|261 pb |style="background: #cbff7B"|<center>300 pb</center> |- |align="center"|PCR_125' |align="center"|pFlgB |align="center"|1 |align="center"|10 to 17 |align="center"|261 pb |style="background: #cbff7B"|<center>300 pb</center> |- |align="center"|PCR_126' |align="center"|pFlhB |align="center"|2 |align="center"|2 to 9 |align="center"|260 pb |style="background: #cbff7B"|<center>300 pb</center> |- |align="center"|PCR_127' |align="center"|pFlhDC |align="center"|2 |align="center"|10 to 17 |align="center"|446 pb |style="background: #ff6d73"|<center>1,000 pb</center> |} ==> '''Conclusion:''' *PCR of pFlgA, pFlgB and pFlhB have succeed, but we always have a problem with pFlhDC probably because of the primers which are not specific.

Return to Team:Paris/August 8.

• Recent changes
• What links here
• Related changes
• Special pages
• My preferences

• Privacy policy
• Disclaimers