User:Caleb Dulaney/How to make BioBricks

=BioBrick Construction=
BioBricks are simply genetic "parts".  They are made up of a length of DNA capped by a prefix and suffix.
*Prefix: the prefix is DNA located before the actual gene you're using.  
* If the sequence codes for protein it is:  gaattcgcggccgcttctag
* If not, the sequence is:                  gaattcgcggccgcttctagag

*Suffix: the suffix is DNA located after the gene. 
* No matter what type of part you're using, the suffix is:  tactagtagcggccgctgcag

These additions to the DNA sequence simply encode for standard restriction enzyme cutting areas and allow the parts to be easily moved around and attached to each other.