|
|
| (15 intermediate revisions not shown) |
| Line 1: |
Line 1: |
| | + | <!--- The Mission, Experiments ---> |
| | + | [[image:331.jpeg|center|]] |
| | {| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="100%" align="center" | | {| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="100%" align="center" |
| | !align="center"|[[Team:Tsinghua|HOME]] | | !align="center"|[[Team:Tsinghua|HOME]] |
| Line 10: |
Line 12: |
| | |} | | |} |
| | == PHA Project == | | == PHA Project == |
| | + | [[Project Description ]] |
| | | | |
| | + | [[Designed Charts]] |
| | | | |
| - | == == Template resources == ==
| + | [[Molecular Cloning]] |
| | | | |
| | + | [[WetLab Results]] |
| | | | |
| | + | [[PHA Project Modeling]] |
| | | | |
| | + | [[Reference]] |
| | | | |
| - | == == Primers == ==
| |
| | | | |
| - |
| |
| - |
| |
| - | == == PCR == ==
| |
| - |
| |
| - |
| |
| - | Cloning
| |
| - | Testing strategy
| |
| - | Results
| |
| - |
| |
| - |
| |
| - |
| |
| - | DNA Template Resources:<br>
| |
| - | PhbCAB: PBHR68 Plasmid<br/>
| |
| - | Lac I: PET28a
| |
| - | CRE:
| |
| - | PpPhaP: Ralstonia eutropha H16 genome
| |
| - | PrPhaR:
| |
| - |
| |
| - | <span style="color: Orange">Ralstonia eutropha H16 genome</span>
| |
| - | SRRz:
| |
| - | EGFP:
| |
| - |
| |
| - |
| |
| - | Primers:
| |
| - | (1) SRRz Primers
| |
| - | IGEM-ZouYLP-SRRZ-NcoI-for
| |
| - | 5- ATCCATGGATGAAGATGCCAGAAAAACATGACCTGTTG-3
| |
| - |
| |
| - | IGEM   -ZouYLP-SRRZ-rev-in
| |
| - | 5 - ACCCCGCCGAAGCGGGGTTTTTTTTTCTACTATCTGCACTGCTCATTAATA-3
| |
| - |
| |
| - | IGEM-ZouYLP-SRRZ-BamHI-rev-out
| |
| - | 5 -TATGGATCCAAAAAAAAACCCCGCCGAAGCGGGGTT-3
| |
| - |
| |
| - | (2)
| |
| - | IGEM-ZouYLP-PP-PhaP-NotI-for
| |
| - | 5- TATGCGGCCGCTGTTTGTGCATTGCACAAAATCCA-3
| |
| - |
| |
| - | IGEM-ZouYLP-PP-PhaP-HindIII-rev
| |
| - | 5- CACCATGTCGACTTTCTCCTCTTTAAGCTTTCAGGCAGCCGTCGTCTTCTTTG-3
| |
| - |
| |
| - | IGEM-ZouYLP-LacILVA-HindIII-for
| |
| - | 5-TGCCTGAAAGCTTAAAGAGGAGAAAGTCGACATGGTGAATGTGAAACCAGTAAC-3
| |
| - |
| |
| - | IGEM-ZouYLP-LacILVA-rev-in
| |
| - | 5- AGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCCTGCCCGCTTTCCAGTCGGGAAACCT-3
| |
| - |
| |
| - | IGEM-ZouYLP-LacILVA-rev-PstI-out
| |
| - | 5- ATTGGACATGCGCGCTTTCTCCTCTTTCTGCAGTTATTAAGCTACTAAAGCGTAGTTTT-3
| |
| - |
| |
| - | IGEM-ZouYLP-CreT7ter—PstI-for
| |
| - | 5- TGCAGAAAGAGGAGAAAGCGCGCATGTCCAATTTACTGACCGTACACCAAAATT-3
| |
| - |
| |
| - | IGEM-ZouYLP-CreT7ter-rev-in
| |
| - | 5-AGCGGGGTTTTTTTTTCTACTAATCGCCATCTTCCAGCAG-3
| |
| - |
| |
| - | IGEM-ZouYLP-CreT7ter-EcoRI-rev-out
| |
| - | 5-ATGAATTCGAGCTCGAAAAAAAAACCCCGCCGAAGCGGGGTTTTTTTTTCTACTAAT-3
| |
| - |
| |
| - | (3)
| |
| - | IGEM-ZouYLP-PR-PhaR-NotI-for
| |
| - | 5-ATGCGGCCGCAGTGCCTTGTTGGGCATAGAATCAGGGCAGCGGCGCAGC-3
| |
| - |
| |
| - | IGEM-ZouYLP-PR-PhaR-NdeI-rev
| |
| - | 5-ACGAAGTTATCATATGTTATTACTTCTTGTCCGGCTGGTTGAACGGGAACGTCCCGAAC-3
| |
| - |
| |
| - | IGEM-ZouYLP-LRLacILP-for-in
| |
| - | 5-TGCTATACGAAGTTATAAAGAGGAGAAACTCGAGATGGTGAATGTGAAACCAGTAACGT-3
| |
| - |
| |
| - | IGEM-ZouYLP-LRLacILP-NdeI-for-out
| |
| - | 5-ACAAGAAGTAATAACATATGATAACTTCGTATAATGTATGCTATACGAAGTTATAAAGA-3
| |
| - |
| |
| - | IGEM-ZouYLP-LRLacILP-rev-in
| |
| - | 5-TACGAAGTTATCTACTGCCCGCTTTCCAGTCGGGAAACCT-3
| |
| - |
| |
| - | IGEM-ZouYLP-LRLacILP-KpnI-rev-out
| |
| - | 5-ATGGTACCATAACTTCGTATAGCATACATTATACGAAGTTATCTACTGCCCGCTT-3
| |
| - |
| |
| - | (4) EGFP
| |
| - | IGEMZouYLP-EGFP-for-KoZg-for
| |
| - | 5-ccatgggcagcaagggcgaggagctgttc-3
| |
| - |
| |
| - | IGEMZouYLP-EGFP-rev-in
| |
| - | 5-AAAAAAAAACCCCGCCGAAGCGGGGTTTTTTTTTCTATCACTTGTACAGCTCGTC-3
| |
| - |
| |
| - | IGEMZouYLP-EGFP-rev-out
| |
| - | 5-TTTTC GAGCTC GAATTC GGATCCAAAAAAAAACCCCGCCGAA-3
| |
| - |
| |
| - | IGEMZouYLP-EGFP-KoZg-rev
| |
| - | 5-TTTTCGAGCTCGAATTCGG-3
| |
| - |
| |
| - |
| |
| - | Designed Molecule
| |
| - |
| |
| - | [[Image:SRRz-Duet.jpg]]
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | [[Image:EGFP-Duet.jpg]]
| |
| - |
| |
| - |
| |
| - |
| |
| - | Plasmid constructs:
| |
| - | 1 pUCPhbCAB
| |
| - |
| |
| - | 2 pACYC(lacI+) DuetSRRz
| |
| - |
| |
| - | 3 pACYC(lacI+) DuetEGFP
| |
| - |
| |
| - | 4 pACYC(lacI-) DuetSRRz
| |
| - |
| |
| - | 5 pACYC(lacI-) DuetEGFP
| |
| - |
| |
| - | 6 pACYC(LacI-)DuetSRRzPpPhaPLacILVACret7terPrPhaRLoxPLacILoxP
| |
| - |
| |
| - | 7 pACYC(LacI-)DuetEGFPPpPhaPLacILVACret7terPrPhaRLoxPLacILoxP
| |
| - |
| |
| - |
| |
| - |
| |
| - | Cloning Strategy:
| |
| - | (1) Fragment Preparation:
| |
| - | SRRz: PCR with primer SRRZ-NcoI-for and SRRZ-rev-in;
| |
| - | Purify the product and run PCR with primer SRRZ-NcoI-for and primer SRRZ-BamHI-rev-out;
| |
| - |
| |
| - | EGFP: PCR with primer EGFP-for-KoZg-for and EGFP-rev-in;
| |
| - | Purify the product and run PCR with primer EGFP-for-KoZg-for and primer EGFP-rev-out;
| |
| - |
| |
| - | PpPhaP: PCR with primer PP-PhaP-NotI-for and PP-PhaP-HindIII-rev;
| |
| - |
| |
| - | LacI(LVA): PCR with primer LacILVA-HindIII-for and LacILVA-rev-in;
| |
| - | Purify the product and run PCR with primer LacILVA-HindIII-for and primer LacILVA-rev-PstI-out;
| |
| - |
| |
| - | CRE(T7ter): PCR with primer CreT7ter—PstI-for and CreT7ter-rev-in
| |
| - | Purify the product and run PCR with primer CreT7ter—PstI-for and CreT7ter-EcoRI-rev-out;
| |
| - |
| |
| - | PrPhaR: PCR with primer PR-PhaR-NotI-for and PR-PhaR-NdeI-rev;
| |
| - |
| |
| - | LoxPLacILoxP: PCR with primer LRLacILP-for-in and LRLacILP-rev-in
| |
| - | Purify the product and run PCR with primer LRLacILP-NdeI-for-out and primer LRLacILP-KpnI-rev-out.
| |
| - |
| |
| - | (2) Fragment Fusion
| |
| - | Fuse LacI(LVA) and CRE(T7ter) together and amplify with the primer LacILVA-HindIII-for and CreT7ter-EcoRI-rev-out;
| |
| - | Fuse PrPhaR and LoxPLacILoxP together and amplify with the Primer PR-PhaR-NotI-for and LRLacILP-KpnI-rev-out.
| |
| - | We’ve tried to fuse more by PCR, but failed.
| |
| - | (3) Vector preparation
| |
| - | We choose pACYCDuet-1 as our second vector while PhbCAB operon is cloned into PUC18.
| |
| - | Since lacI is one of the elements we also used in our own system, we knocked out the lacI coding region in pACYCDuet-1 successfully.
| |
| - | (4) Cut and Insert
| |
| - | The restriction enzymes are chosen as following:
| |
| - | Fragment Enzyme A Enzyme B
| |
| - | SRRz/EGFP NcoI BamHI
| |
| - | PpPhaP NotI HindIII
| |
| - | LacI(LVA)Cre(T7ter) HindIII SacI
| |
| - | PrPhaRLoxPLacILoxP NotI KpnI
| |
| - |
| |
| - | == Reference ==
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | 1
| |
| - | A sensitive, viable-colony staining method using Nile red
| |
| - | for direct screening of bacteria that accumulate polyhydroxyalkanoic
| |
| - | acids and other lipid storage compounds. Patricia Spiekermann · Bernd H. A. Rehm ·
| |
| - | Rainer Kalscheuer · Dirk Baumeister ·
| |
| - | Alexander Steinbüchel. Arch Microbiol (1999) 171:73–80
| |
| - |
| |
| - | '''This literature explains how pBHR68 works and how PHA granules are detected.'''
| |
| - |
| |
| - | 2 Construction and Selection of the Novel Recombinant Escherichia cob Strain for Poly(Hydroxybutyrate) Production.HUIMIN YU,JIN YIN,HONGQI LI,SHENGLI YANG,AND ZHONGYAO. JOURNALOF BIOSCIENCEAND BIOENGWEERING
| |
| - | Vol. 89, No. 4, 307-311. 2000
| |
| - |
| |
| - | '''This literature indicates how PHA sysnthesis is realized in Escherichia coli.'''
| |
| - |
| |
| - | 3 Spontaneous liberation of intracellular polyhydroxybutyrate granules in Escherichia coli.Il Lae Jung, Ki Heon Phyo, Kug Chan Kim, Hyo Kook Park, In Gyu Kim.Research in Microbiology 156 (2005) 865–873
| |
| - |
| |
| - | '''This literature introduced a method to release PHB granules from Escherichia coli.'''
| |
| - |
| |
| - | 4 Simultaneous Expression of Vitreoscilla Globin Gene and Lytic Genes of Phage lambda Novel RecombinantEscherichia Coli Used for Production of PHB.YU Huimin,SHI Yue,YIN Jin,and SHEN Zhongyao.ChineseJ.ofChem.Eug，(4)407一411(2001)
| |
| - |
| |
| - | '''This literature introduced phage lambda lytic gene into Escherichia coli strains.'''
| |
| - |
| |
| - | 5 Autoregulator Protein PhaR for Biosynthesis of Polyhydroxybutyrate [P(3HB)] Possibly Has Two Separate Domains That Bind to the Target DNA and P(3HB): Functional Mapping of Amino Acid Residues Responsible for DNA Binding.Miwa Yamada,Koichi Yamashita,Akiko Wakuda,Kazuyoshi Ichimura,Akira Maehara,Michihisa Maeda,and Seiichi Taguchi.JOURNAL OF BACTERIOLOGY, Feb. 2007, p. 1118–1127
| |
| - |
| |
| - | '''This literature illustrates how PhaR works in the PHB synthesis regulation.'''
| |
| - |
| |
| - | 6 Influence of homologous phasins (PhaP) on PHA accumulation and regulation of their expression by the transcriptional repressor PhaR in Ralstonia eutropha H16.Markus Po¨tter, Helena Muller and Alexander Steinbuchel.Microbiology (2005), 151, 825–833.
| |
| - |
| |
| - | '''This literature illustrates in the interaction of PhaP and PhaR.'''
| |
| | | | |
| | {| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="100%" align="center" | | {| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="100%" align="center" |
| Line 230: |
Line 36: |
| | !align="center"|[[Team:Tsinghua/Doodle|Doodle Board]] | | !align="center"|[[Team:Tsinghua/Doodle|Doodle Board]] |
| | |} | | |} |
| | + | <!--- The Mission, Experiments ---> |
| | + | [[image:06.jpeg|center|]] |
"
