Team:NYMU-Taipei/Project/pH Sensor

From 2008.igem.org

(Difference between revisions)
(NhaA promoter under 0uM, 150uM, 300uM sodium and pH 3.0, 7.0, 8.5)
 
(2 intermediate revisions not shown)
Line 49: Line 49:
* [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T1S-4CVR4C8-1&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=5cb90ff8555f4439c804a59f5b397c16 NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+antiporter] (E. Padan etc., 2004)
* [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T1S-4CVR4C8-1&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=5cb90ff8555f4439c804a59f5b397c16 NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+antiporter] (E. Padan etc., 2004)
* [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)
* [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)
 +
 +
== Experiments ==
 +
 +
=== ''NhaA'' promoter under 300uM sodium and pH 3.0, 7.0, 8.5 ===
 +
 +
 +
{|
 +
|
 +
[[Image:PNhaA 20081025 300uM Na 3.5h.png|400px]]
 +
|-
 +
|}
 +
{{:Team:NYMU-Taipei/Footer}}
{{:Team:NYMU-Taipei/Footer}}

Latest revision as of 05:10, 30 October 2008

NYMU Banner-wider 965px.png


Contents

Motivation

  • When our system arrives in the intestine (pH is higher), it senses the pH change and starts to work.
  • In this subsystem, we are going to create a pH sensor which senses high pH's.

Goal

  • The pH sensor can sense a high pH condition and start gene expression.

Circuit Design

Regulation of nhaA gene expression

  • [http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=178537&blobtype=pdf Na1-Induced Transcription of nhaA, Which Encodes an Na1/H1 Antiporter in Escherichia coli, Is Positively Regulated by nhaR and Affected by hns] (N. DOVER etc.,1996)
  • [http://jeb.biologists.org/cgi/content/abstract/196/1/443 Molecular physiology of the Na+/H+ antiporter in Escherichia coli] (E Padan and S Schuldiner, 1994)

NYMU IGEM08 NhaA regulation.png NYMU NhaA protein expression and activity regulated by pH.png

Structure of nhaA gene promoter

  • [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)

NYMU Promoter elements of nhaA.png

  • 17,189 -17,488 in E.coli K12 genome from Ecocyc (300 bp upstream of nhaA gene)

00000000011111111112222222222344444444455555555556666666666777777777788888888889
12345678901234567890123456789012345678901234567890123456789012345678901234567890
ACGACAAGCTGGATTATTTTTGAAATATTGGCCTAACAAGCATCGCCGACTGACAACAAATTAATTATTACTTTTCCTAA
TTAATCCCTCAGGAATCCTCACCTTAAGCTATGATTATCTAGGCTTAGGGTCACTCGTGAGCGCTTACAGCCGTCAAAAA
CGCATCTCACCGCTGATGGCGCAAATTCTTCAATAGCTCGTAAAAAACGAATTATTCCTACACTATAATCTGATTTTAAC
GATGATTCGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCTGAAAGAGAAATAAAAA 
  • G is the start of NhaR binding site
  • TTTTAA is the first -35 of P1
  • ATGATT is the second -35 of P1
  • TAAAAT is the first -10 of P1
  • TAAAAA is the second -10 of P1; A in the TAAAAA is the first TSS of P1
  • AAGAGA is the S.D. (Shine-Dalgarno) sequence in RBS
  • There are 3 nhaA promoter sequences protected by NhaR from DNase I digestion
    • AATAGCTCGTAAAAAACGAATTATTCC
    • CACTATAATCTGATTTTAACGATG
    • CGTGCGGGGTAAAATAGTAAAAACGATCTATTCACCT; T in TTCACCT is the second TSS of P1
  • The extracted DNA sequence should include the NhaR binding site
    • The NhaR binding site defined in (Nir Dover and Etana Padan et al.,2001) is 120 bp long
    • The PCR product derived from primers designed by Henry is 274 bp long

References

  • [http://jeb.biologists.org/cgi/content/abstract/196/1/443 Molecular physiology of the Na+/H+ antiporter in Escherichia coli] (E Padan and S Schuldiner, 1994)
  • [http://www.pnas.org/cgi/content/abstract/90/4/1212 Histidine-226 is part of the pH sensor of NhaA, a Na+/H+ antiporter in Escherichia coli] (Y Gerchman etc., 1993)
  • [http://www.nature.com/nature/journal/v435/n7046/full/nature03692.html Structure of a Na+/H+ antiporter and insights into mechanism of action and regulation by pH] (Carola Hunte etc., 2005)
  • [http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=178537&blobtype=pdf Na1-Induced Transcription of nhaA, Which Encodes an Na1/H1 Antiporter in Escherichia coli, Is Positively Regulated by nhaR and Affected by hns] (N. DOVER etc.,1996)
  • [http://jeb.biologists.org/cgi/content/abstract/196/1/443 Molecular physiology of the Na+/H+ antiporter in Escherichia coli] (E Padan and S Schuldiner, 1994)
  • [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6T1S-4CVR4C8-1&_user=10&_rdoc=1&_fmt=&_orig=search&_sort=d&view=c&_acct=C000050221&_version=1&_urlVersion=0&_userid=10&md5=5cb90ff8555f4439c804a59f5b397c16 NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+antiporter] (E. Padan etc., 2004)
  • [http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11133959 Transcription of nhaA, the Main Na+/H+ Antiporter of Escherichia coli, Is Regulated by Na+ and Growth Phase] (Nir Dover and Etana Padan et al.,2001)

Experiments

NhaA promoter under 300uM sodium and pH 3.0, 7.0, 8.5

PNhaA 20081025 300uM Na 3.5h.png