"
Team:University of Washington/Protocols
From 2008.igem.org
(→Electrocompetent Cells (One Sample)) |
(→Lambda Red Recombination) |
||
| Line 14: | Line 14: | ||
== Lambda Red Recombination == | == Lambda Red Recombination == | ||
''This is for site-directed mutagenesis of chromosomes or large plasmids'' | ''This is for site-directed mutagenesis of chromosomes or large plasmids'' | ||
| + | |||
1. Amplify antibiotic resistance cassette with primers that are homologous to cassette and your region of interest. | 1. Amplify antibiotic resistance cassette with primers that are homologous to cassette and your region of interest. | ||
*For Kan: | *For Kan: | ||
| Line 20: | Line 21: | ||
*For Tet: | *For Tet: | ||
*By PCR - 95C 1' 1X; 95C 1', 45C 1', 72C 2' 30X; 72C 10' 1X; 4C hold. | *By PCR - 95C 1' 1X; 95C 1', 45C 1', 72C 2' 30X; 72C 10' 1X; 4C hold. | ||
| + | |||
2. Run small aliquot on gel to verify. | 2. Run small aliquot on gel to verify. | ||
| + | |||
3. Qiagen PCR purification kit, elute with water. | 3. Qiagen PCR purification kit, elute with water. | ||
| + | |||
4. Transform 15 uL into cells that express lambda red machinery | 4. Transform 15 uL into cells that express lambda red machinery | ||
**If these cells have machinery on pKD46 plasmid: Grow O/N culture at 30C, Sub 1:100 in LB Amp100 + 0.2% arabinose, grow at 30C until OD600 is around 0.6 to 0.8 (25mLs). Wash 2X in cold water (25 mLs, spin 7' at 7K RPM), resuspend in water (100 uL) at density high enough for electroporation. | **If these cells have machinery on pKD46 plasmid: Grow O/N culture at 30C, Sub 1:100 in LB Amp100 + 0.2% arabinose, grow at 30C until OD600 is around 0.6 to 0.8 (25mLs). Wash 2X in cold water (25 mLs, spin 7' at 7K RPM), resuspend in water (100 uL) at density high enough for electroporation. | ||
| + | |||
5. Recover with SOC, plate all on selective media. | 5. Recover with SOC, plate all on selective media. | ||
| + | |||
6. Streak for isolation | 6. Streak for isolation | ||
| + | |||
7. Confirm by PCR | 7. Confirm by PCR | ||
Revision as of 19:52, 1 July 2008
Contents |
Electrocompetent Cells (One Sample)
This is for making one/two aliquots of electrocompetent cells
1. Grow overnight culture of your cells
2. Back-dilute 1:50 into 3 mLs (so 60 uL), put on rotator in 37 degree incubator for 3 hours (put water on ice during this time)
3. Pellet in epi tube, top speed for ~20-30 sec
4. Remove supernatant. Wash cells 3X in cold water 1 mL each.
5. Resuspend in 40 uL cold water, add DNA, electroporate
Lambda Red Recombination
This is for site-directed mutagenesis of chromosomes or large plasmids
1. Amplify antibiotic resistance cassette with primers that are homologous to cassette and your region of interest.
- For Kan:
- Primer 1: 5' bp your sequence + GTGTAGGCTGGAGCTGCTTC - 3' (Tm = 64C)
- Primer 2: 5' bp your sequence + CATATGAATATCCTCCTTAG - 3' (Tm = 54C)
- For Tet:
- By PCR - 95C 1' 1X; 95C 1', 45C 1', 72C 2' 30X; 72C 10' 1X; 4C hold.
2. Run small aliquot on gel to verify.
3. Qiagen PCR purification kit, elute with water.
4. Transform 15 uL into cells that express lambda red machinery
- If these cells have machinery on pKD46 plasmid: Grow O/N culture at 30C, Sub 1:100 in LB Amp100 + 0.2% arabinose, grow at 30C until OD600 is around 0.6 to 0.8 (25mLs). Wash 2X in cold water (25 mLs, spin 7' at 7K RPM), resuspend in water (100 uL) at density high enough for electroporation.
5. Recover with SOC, plate all on selective media.
6. Streak for isolation
7. Confirm by PCR
Mini Preps
Qiagen Kit
1. 250μL P1 resuspend pellet
2. 250μL P2
3. 350μL N3
4. Centrifuge full speed 10 min.
5. Decant supernatant into filter cartridge
6. Spin 1 min.
·empty collection tube
7. Add 750μL PE wash buffer
8. Spin 1 min.
·empty collection tube
9. Dry spin 2 min.
10. Put filter cartridge in clean eppendorf tube
11. Add 50μL EB
·Centrifuge 2 min. @ 9000 rpm
QuikChange Mutagenesis
Reference: [http://www.stratagene.com/manuals/200516.pdf Stratagene QuikChange® XL Site-Directed Mutagenesis Kit Instruction Manual]
Prep:
- Design the sequences
- Design primers(>= 40% GC, boiling point >= 78C, length ~25-45 bp, mutation between 10-15 correct bases of sequence, terminate in G or C)
1. Add followings to the thin-walled tube for thermocycling
5 μl 10× reaction buffer
X μl (10 ng) dsDNA template
X μl (125 ng) oligonucleotide primer #1
X μl (125 ng) oligonucleotide primer #2
1 μl dNTP mix
3 μl DMSO
2. Add ddH2O to a final volume of 50 μl 3. Add 1 μl of PfuTurbo DNA polymerase (2.5 U/μl)
Sequencing
From medium- or high-copy miniprepped plasmid DNA obtained via Qiagen kit
1. Dilute primer to 1 pmole/uL (=1 umole/mL)
2. Aliquot 8 uL of primer (=8 pmole) per epi tube for each sequencing reaction (1 primer/tube, so if you are doing forward and reverse reaction, two tubes). Make sure that you use the correct primers for your reaction.
3. Add 4 uL Qiagen-miniprepped plasmid DNA
4. Fill out form on UW DNA Sequencing Facility website. Make sure that you are connected to a printer for this. Use budget number: 75-1064, Box number: 355761. If you do not already have an account, you will have to make one. Use your own phone number, and Herbert's info for PI information (Box 355061, William H. Foege Building, Room N210E). Select "Plasmid DNA", give short description to each tube. Write down the number they give you (usually your initials and then some number) on the top of the epindorf tube. At the bottom, select "Rxn and analysis" and "BDSF's Choice", and NO for printing.
5. Print out two copies of the form, one on colored paper (or on white paper that you can then scribble around the edges with a highlighter or a Sharpie). Give the other copy to Ingrid.
6. Submit to sequencing on the 2nd floor of the Hitchcock building. Turn in the colored form where it says "Drop off". Place your samples in the fridge that says "Rxn and analysis", anywhere in a box that says "Template and primer mix".
Team:University_of_Washington/Project
