"
Template:Team:UC Berkeley/Notebook/DV construction
From 2008.igem.org
(Difference between revisions)
Dirkvandepol (Talk | contribs) (→K112703 again) |
|||
| Line 148: | Line 148: | ||
==K112711== | ==K112711== | ||
<pre> | <pre> | ||
| - | Construction of SpvR basic part K112711 | + | Construction of rbs.SpvR! basic part K112711 |
| - | PCR of SpvR al0027 and al0028 [template] | + | PCR of rbs.SpvR! al0027 and al0028 [template] |
Sub into pBca1256 (EcoRI/BamHI, 2472+(SpvR length), L) | Sub into pBca1256 (EcoRI/BamHI, 2472+(SpvR length), L) | ||
Product is pBca1256-K112711 | Product is pBca1256-K112711 | ||
------------------------------------------------ | ------------------------------------------------ | ||
| - | al0027 Forward Biobricking of spvR CCATAGAATTCatgAGATCTAAAAAAGGAGATATTATGGATTTCTTG | + | al0027 Forward Biobricking of rbs.spvR! CCATAGAATTCatgAGATCTAAAAAAGGAGATATTATGGATTTCTTG |
| - | al0028 Reverse Biobricking of spvR CGttaGGATCCaggtcagaaggtggactg | + | al0028 Reverse Biobricking of rbs.spvR! CGttaGGATCCaggtcagaaggtggactg |
</pre> | </pre> | ||
Revision as of 18:53, 2 July 2008
Contents |
K112701
Construction of [<Phns>] Basic Part K112701 PCR dv001/dv006 on Phns from E. coli K12 MG1655 (~342 bp, gp = A) PCR dv005/dv003 on Phns from E. coli K12 MG1655 (225 bp, gp = B) PCR dv004/dv002 on Phns from E. coli K12 MG1655 (~149 bp, gp = C) --------------------------------------------------- PCR dv001/dv003 on A+B (355 bp, gp = D) --------------------------------------------------- PCR dv001/dv002 on C+D (697bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+697) Product is pBca1256-K112701 ----------------------------------------------- dv001 Forward Biobricking of [<Phns>] CgATAgaattcATGagatctGAAATATAGCTGTGCCATCAGCC dv002 Reverse Biobricking of [<Phns>] cagtcggatccGCACGAAGAGTACGGATG dv003 Removing the 2nd EcoRI site in [<Phns>] (R) GCCAGGAATGTAAGGgATTCAAAATTGTTC dv004 Removing the 2ND EcoRI site in [<Phns>] (F) GAACAATTTTGAATcCCTTACATTCCTGGC dv005 Removing the FIRST EcoRI site in [<Phns>] (F)CGCTTAATAGGGgATTCTCGTAAACAC dv006 Removing the FIRST EcoRI site in [<Phns>] (R)GTGTTTACGAGAATcCCCTATTAAGCG
K112703
Construction of His-Tag> basic part K112703 Mix dv009/dv010 (41bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+41, L) Product is pBca1256-K112703 ----------------------------------------------- dv009 Forward Biobricking of His-Tag> cgataGAATTCatgAGATCTatgCATCATCATCATCATCATGGATCCtaacg dv010 Reverse Biobricking of His-Tag> cgttaGGATCCATGATGATGATGATGATGcatAGATCTcatGAATTCtatgg
K112704
Construction of <S-tag! basic part K112704 Wobble PCR of dv011/dv012 (60 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI) Product is pBca1256-K112704 ---------------------------------------- dv011 Forward Biobricking of <S-Tag! cgataGAATTCatgAGATCTaaagaaaccgctgctgctaaattcgaacgcc dv012 Reverse Biobricking of <S-Tag! cgttaGGATCCttagctgtccatgtgctggcgttcgaatttagcagc
K112705
Construction of S-tag> basic part K112705 Wobble PCR dv013/dv014 (47 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+47, L) Product is pBca1256-K112705 ----------------------------------------------- dv013 Forward Biobricking of S-Tag> cgataGAATTCatgAGATCTatgaaagaaaccgctgctgctaaattcg dv014 Reverse Biobricking of S-Tag> cgttaGGATCCgctgtccatgtgctggcgttcgaatttagcagcagcgg
K112706
Construction of <Pspv2> basic part K112706 PCR of dv015/dv016 on pBca1037 (500bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+ 500, L) Product is pBca1256-K112706 ----------------------------------------------- dv015 Forward biobricking of <Pspv2> cgataGAATTCatgAGATCTccttatgcagcgtaagggccgcaac dv016 Reverse biobricking of <Pspv2> cgttaGGATCCGATAATGTtTGCAGGGGAATTATTTTG
K112707
Construction of <Pspv> basic part K112707 PCR of dv017/dv016 on pBca1037 (499bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+499, L) Product is pBca1256-K112707 ----------------------------------------------- dv017 Forward biobricking of <Pspv> cgataGAATTCatgAGATCTaGATCCTGTGATGTTTGGCG dv016 Reverse biobricking of <Pspv> cgttaGGATCCGATAATGTtTGCAGGGGAATTATTTTG
K112708
Construction of <PfhuA> basic part K112708 PCR of dv019/dv020 on MG1655 (225bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+225, L) Product is pBca1256-K112708 ----------------------------------------------- dv019 Forward biobricking of <PfhuA> cgataGAATTCatgAGATCTgctaagcgtgaaataccggatgg dv020 Reverse biobricking of <PfhuA> cgttaGGATCCactctgatgtaaagtgaatgataacg
K112709
Construction of <b1006> basic part K112709 Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+66, L) Product is pBca1256-K112709 ----------------------------------------------- dv021 Forward biobricking of b1006 cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg dv022 Reverse biobricking of b1006 GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt
K112710
Construction of <Bca1041> basic part K112710 PCR of dv023/dv024 pSB1AG0-Bca1041 (122bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+122, L) Product is pBca1256-K112710 ----------------------------------------------- dv023 Forward biobricking of Bca1041 cgataGAATTCatgAGATCTgCcggcttatcGgtcagtttc dv024 Reverse biobricking of Bca1041 cgttaGGATCCatttcttttgggtatagcgtcgtgg
K112711
Construction of rbs.SpvR! basic part K112711 PCR of rbs.SpvR! al0027 and al0028 [template] Sub into pBca1256 (EcoRI/BamHI, 2472+(SpvR length), L) Product is pBca1256-K112711 ------------------------------------------------ al0027 Forward Biobricking of rbs.spvR! CCATAGAATTCatgAGATCTAAAAAAGGAGATATTATGGATTTCTTG al0028 Reverse Biobricking of rbs.spvR! CGttaGGATCCaggtcagaaggtggactg
K112703 again
Construction of His-tag> basic part K112703, 2nd attempt EIPCR of His-tag> dv025 and ca1246R on pBca1256 (2704bp EcoRI/BamHI,) Cyclize pBca1256-K112703 (EcoRI) Product is pBca1256-K112703 dv025 Forward Biobricking of His-tag> ctagtGAATTCatgGGATCCtaaCTCGAcgtgcagg ca1246R Reverse EIPCR from mRFP to facilitate Biobricking of His-tag> GACCTTCACCTTCACCTTCG
