Team:Edinburgh/Project/Labwork Summary/17 June 08
From 2008.igem.org
Line 91: | Line 91: | ||
'''Wednesday 2 July 2008''' | '''Wednesday 2 July 2008''' | ||
+ | |||
Digests of M10 and M11 with EcoRI, to determine orientation, were not very clear (Gel 7). Probably simpler just to sequence them, since we will need to check that the ends are intact in any case. Ordered mutagenic primers to remove the EcoRI sites: | Digests of M10 and M11 with EcoRI, to determine orientation, were not very clear (Gel 7). Probably simpler just to sequence them, since we will need to check that the ends are intact in any case. Ordered mutagenic primers to remove the EcoRI sites: | ||
primer glgcm1f: tgttgaaaaacctgctaaccc | primer glgcm1f: tgttgaaaaacctgctaaccc |
Revision as of 11:23, 3 July 2008
iGEM 2008 Labwork Summary
Tuesday 17 June 08
Prepared competent JM109 cells using TSS method. 25 tubes of 0.2 ml were prepared, labelled 'iGEM 17-6-8 Jnn' where nn is a number from 01 to 25. These are in the pink box in Garry's -80 C freezer. Thursday 19 June 08 Eluted DNA for BioBrick E0240 (GFP) from square 1001, well 4B and used this to transform half of tube J25; other half was transformed with 1.5 microlitres of J33207 (Edinbrick1) as a control to test the competence of the cells. Plated 100 microlitres of each to LA+amb+BW. Incubate at 37 C overnight. Plate 1: JM109 transformation with E0240 eluted DNA. Plate 2: JM109 transformation with J33207 plasmid DNA (control).
Friday 20 June 08
Result of transformation: the positive control was highly successful, with hundreds of colonies, but no colonies were present on the plate transformed with the BioBrick DNA indicating some problem with the DNA elution. Need to check that we got the method right. Ordered primers for dxs, appY and glgC. There are no forbidden restriction sites in the first two, so primers with full prefix and partial suffix were ordered to clone as EcoRI-SpeI fragments, but glgC has two EcoRI sites which will have to be mutated out. We therefore had a choice of cloning it initially as a XbaI-PstI fragment, or attempting the BABEL system, and decided to try BABEL first. If it proves too unreliable, we will need to order new primers to clone it the old-fashioned way. Primer dxsf1: gat gaattc gcggccgc t *tctaga+ tg agt ttt gat att gcc Primer dxsr1: gc t actagt a tt a tta tgc cag cca ggc ctt g Primer appyf1: gat gaattc gcggccgc t tctaga tg gat tat gtt tgc tcc Primer appyr1: gct actagt a tta tt a gtc aat tgt ttt gtt tat tcc Primer glgcf1: atg gtt agt tta gag aag aac gat c Primer glgcr1: tta tta tcg ctc ctg ttt atg ccc taa c
Tuesday 24 June 08
Sarah S wants to revive one of the BioBricks from the Registry (pBad-GFP), so we'll see whether she can get it to work. Wednesday 25 June 08 Primers arrived. Made up 500 uM stock solutions in EB and 10 uM working solutions (f and r together) in water. Performed PCR with Kod, annealing at 55 C and extending for 38 seconds (expected sizes are: dxs 1862+prefix and suffix; appY 749+prefix and suffix; glgC 1295 with no prefix or suffix (except the extra TAA). Result: all looked good, nice pure bands. Gel 1: markers, empty lane, dsx, appY, glgC, appY (repeat), glgC (repeat), markers.
Thursday 26 June 08
Purified DNA from PCR reactions. Used 20 microlitres of glass beads and eluted to 40 microlitres of TE. Sample P1: dsx PCR product Sample P2: appY PCR product Sample P3: glgC PCR product
Set up digests to clone appY and dxs in Edinbrick1. Digests with 32 microlitres water, 5 microlitres buffer E, 4 microlitres Edinbrick1 DNA, 4 microlitres purified PCR product, 2.5 microlitres SpeI, 2.5 microlitres EcoRI. Incubated at 37 C. Purified. Set up ligations: Ligation L1: dsx + Edinbrick1, E/S Ligation L2: appY + Edinbrick1, E/S Ligation L3: glgC (5 ul) +linear Babel1 (16-2-8, 2 ul) with PNK Ligation L4: glgC (5 ul) +linear Babel2 (18-2-8, 2 ul) with PNK
Incubate ligations at 16 C overnight.
Friday 27 June 08
Ordered Cellulomonas fimi ATCC 484 (NCIB 8980, DSM 20113) from DSMZ. Transformations of the iGEM competent JM109 cells with ligations L1 to L4. In each case, 100 microlitres of cells were transformed with 5 microlitres of ligation, and the remaining 5 microlitres of each ligation was frozen so that it could be analysed if the transformations fail. Fresh Blue-White Ampicillin plates were prepared. Plate 3: Ligation L1, 100 microlitres Plate 4: Ligation L2, 100 microlitres Plate 5: Ligation L3, 100 microlitres Plate 6: Ligation L4, 100 microlitres Plate 7: Ligation L1, 900 microlitres Plate 8: Ligation L2, 900 microlitres Plate 9: Ligation L3, 900 microlitres Plate 10: Ligation L4, 900 microlitres
Saturday 28 June 08
Result of transformations: Plate 3: 1 white; Plate 7: 5 white, 13 blue. Plate 4: no growth; Plate 8: no growth. Plate 5: 1 white; Plate 9: 3 white, 20 blue, possible signs of phage. Plate 6: maybe one tiny white; Plate 10: 7 white, 9 blue.
The white colonies were transferred to fresh plates of the same medium:
Plate 11: possible Edinbrick-dxs transformants. Plate 12: possible Babel1-glgC transformants. Plate 13: possible Babel2-glgC transformants.
The new plates were incubated at 37 C. The old plates were left at room temperature to see if any further colonies would appear.
Sunday 29 June 08
Streaks on plate 12 show strong signs of phage infection and are unusable apart from the single white one from plate 5. At least one of the streaks on plate 13 also has a couple of plaques, but plate 11 looks fine. This suggests that phage may have come from the Babel DNA stock (or the PNK, which seems unlikely). Set up overnight cultures (2.5 ml LB in 20 ml bijoux) for minipreps. Numbers 1 to 6 are Edinbrick-dxs from plate 11, all white, number 7 is from plate 12 (the white clone from plate 5), and 8 to 12 are from plate 13, white or pale blue. Incubated at 37 C with shaking. Also note: a couple more colonies turned up on plates 5 and 6. The one on 6 looks like an escape, but the one on 5 looks OK. Subbed them both to a fresh plate (Plate 14). Previous plates, apart from plates 4 and 8 which had no growth, were transferred to the cold storage room. Monday 30 June 08 Plasmid DNA minipreps: M1 to M6: Edinbrick-dxs white colonies M7: Babel1-glgC white colony M8 to M12: Babel2-glgC white and pale blue colonies
Minipreps M1 to M6 were digested with EcoRI and PstI (Gel 2). The expected pattern is pSB1A2 vector band at 2.04 kb (2079 bp less prefix and suffix) and dxs insert band around 1.9 kb. M1 showed bands around 1.1 and 2.1 kb. M5 showed no DNA. The other four showed a vector-like band around 2 kb and a fainter, fuzzier band around 3 kb, possibly a 'ghost' band. Thus none of the clones show the expected pattern of bands (although it is conceivable, since the vector and insert bands are so close in size, that they may be lying on top of each other; dxs has an internal EcoRV site at +504 and two HindIII sites at +606 and +1230, whereas pSB1A2 lacks such sites so this could be used to check). In conjunction with the total lack of growth on the appY plates, this suggests that something went wrong in the cloning procedure. The next step is to run the remaining ligation material on a gel and see what it looks like.
Tuesday 1 July 2008
Gel 3: minipreps M2, M3, M4 and M6 (pSB1A2-dxs clones) digested with EcoRI alone; lanes 5 and 6, 2.5 microlitres of ligations L1 and L2. Result: all 4 minipreps now give a 4.2 kb band (plus the same 3.2 kb 'ghost' band as before) consistent with pSB1A2 carrying a 2 kb insert. Would be nice to confirm identity using HindIII (2 internal sites). Both ligations show clear signs of insert and vector bands (oddly, the dsx insert band overlaps the pSB1A2 vector band whereas the appY insert band overlaps the lacZ' insert excised from Edinbrick1). However, no ligated bands are visible. Thus the DNA purification is fine; if there was a a problem, it is with the ligase or ligase buffer.
Gel 4: minipreps M7 to M12 (supposed to be glgC in Babel vectors) digested with EcoRI and PstI to excise the inserts. M10 and M11 have a single 3 kb band consistent with vector, but no insert band at 1.2 kb. M7, M8, M9 and M12 all show a single band at about 2.4 kb which is not consistent with Babel vectors if properly digested. Unless the digests totally failed, none of these plasmids would seem to contain glgC.
Wednesday 2 July 2008
Digests of M10 and M11 with EcoRI, to determine orientation, were not very clear (Gel 7). Probably simpler just to sequence them, since we will need to check that the ends are intact in any case. Ordered mutagenic primers to remove the EcoRI sites: primer glgcm1f: tgttgaaaaacctgctaaccc primer glgcm1r: aattcgataattttatcgttctc primer glgcm2f: ctcattctgcaacattgattcc primer glgcm2r: ttcacgcgaacgcgcgag