Team:Hawaii/Biobrick conversions

From 2008.igem.org

(Difference between revisions)
(New page: ==Objectives== * Convert GFP (BBa_E0040) into a fusion brick using site-directed mutagenesis. * Convert pRL1383a into a Biobrick vector by replacing its natural MCS with the Biobrick MCS =...)
(→PCR mutagenesis of GFP)
Line 4: Line 4:
==Protocol==
==Protocol==
===PCR mutagenesis of GFP===
===PCR mutagenesis of GFP===
 +
* Combined:
 +
:* 1 μl colony sample (above)
 +
:* 0.5 μl 10mM forward primer
 +
:* 0.5 μl 10mM reverse primer
 +
:* 3 μl nanopure water
 +
:* 5 μl ''Taq'' (we used EconoTaq Green Taq)
 +
* Ran for 30 cycles of denaturing, annealing, extension
 +
:* Initial denature @ 94C for 2 min.
 +
:* Denature @ 94C for 30 sec.
 +
:* Anneal @ 55C for 30 sec.
 +
:* Extend @ 72C for 60 sec.
 +
:* Final extension @ 72C for 10 min.
 +
:* Held @ 4C inifinitly.
 +
 +
<div style="text-align: center;"> '''GFP fusion brick (site directed mutagenesis)'''</div>
 +
{| border="1" class="wikitable"
 +
! Primer
 +
! Sequence
 +
! Length
 +
! G/C content
 +
! T<sub>m</sub>
 +
! Notes
 +
|-
 +
| align="center"|GFP fusion foward
 +
| align="center"|GCCGCTTCTAGAcgtaaaggag
 +
| align="center"|22 bp
 +
| align="center"|54.55%
 +
| align="center"|60.2 C
 +
| PCR out from E0040, starts annealing from partial NotI (5 of 8 nucleotides of) site, continues with XbaI, omits TG of ATG codon for site directed mutagenesis, begins again with GFP codon 2-4 (cgt aaa gga)
 +
|-
 +
| align="center"|GFP fusion reverse
 +
| align="center"|cgagtcagtgagcgaggaag
 +
| align="center"|20 bp
 +
| align="center"|60%
 +
| align="center"|59.6 C
 +
| PCR out from E0040, priming after all end sites (5'taataa t actagt a gcggccg ctgcag gCTTCCTCGCTCACTGACTCG3')
 +
|-
 +
|}
 +
===Extraction of Biobrick MCS===
===Extraction of Biobrick MCS===
===Subcloning of GFP fusion brick and pRL1383a Biobrick vector===
===Subcloning of GFP fusion brick and pRL1383a Biobrick vector===
==Results==
==Results==
==Discussion==
==Discussion==

Revision as of 08:16, 16 July 2008

Contents

Objectives

  • Convert GFP (BBa_E0040) into a fusion brick using site-directed mutagenesis.
  • Convert pRL1383a into a Biobrick vector by replacing its natural MCS with the Biobrick MCS

Protocol

PCR mutagenesis of GFP

  • Combined:
  • 1 μl colony sample (above)
  • 0.5 μl 10mM forward primer
  • 0.5 μl 10mM reverse primer
  • 3 μl nanopure water
  • 5 μl Taq (we used EconoTaq Green Taq)
  • Ran for 30 cycles of denaturing, annealing, extension
  • Initial denature @ 94C for 2 min.
  • Denature @ 94C for 30 sec.
  • Anneal @ 55C for 30 sec.
  • Extend @ 72C for 60 sec.
  • Final extension @ 72C for 10 min.
  • Held @ 4C inifinitly.
GFP fusion brick (site directed mutagenesis)
Primer Sequence Length G/C content Tm Notes
GFP fusion foward GCCGCTTCTAGAcgtaaaggag 22 bp 54.55% 60.2 C PCR out from E0040, starts annealing from partial NotI (5 of 8 nucleotides of) site, continues with XbaI, omits TG of ATG codon for site directed mutagenesis, begins again with GFP codon 2-4 (cgt aaa gga)
GFP fusion reverse cgagtcagtgagcgaggaag 20 bp 60% 59.6 C PCR out from E0040, priming after all end sites (5'taataa t actagt a gcggccg ctgcag gCTTCCTCGCTCACTGACTCG3')

Extraction of Biobrick MCS

Subcloning of GFP fusion brick and pRL1383a Biobrick vector

Results

Discussion

Retrieved from "http://2008.igem.org/Team:Hawaii/Biobrick_conversions"