Template:Team:UC Berkeley/Notebook/CC construction
From 2008.igem.org
(Difference between revisions)
Cicikashou (Talk | contribs) |
Cicikashou (Talk | contribs) |
||
(13 intermediate revisions not shown) | |||
Line 3: | Line 3: | ||
==K112500== | ==K112500== | ||
<pre> | <pre> | ||
- | Construction of {<HA>} basic part | + | Construction of {<HA>} basic part K112500 |
Wobble PCR of cc001/cc002 ( 50 bp, EcoRI/BamHI) | Wobble PCR of cc001/cc002 ( 50 bp, EcoRI/BamHI) | ||
Line 18: | Line 18: | ||
==K112501== | ==K112501== | ||
<pre> | <pre> | ||
- | Construction of {<HA!} basic part | + | Construction of {<HA!} basic part K112501 |
Wobble PCR of cc001/cc003 ( 53 bp, EcoRI/BamHI) | Wobble PCR of cc001/cc003 ( 53 bp, EcoRI/BamHI) | ||
Line 33: | Line 33: | ||
==K112502== | ==K112502== | ||
<pre> | <pre> | ||
- | Construction of {<myc>} basic part | + | Construction of {<myc>} basic part K112502 |
Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI) | Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI) | ||
Line 63: | Line 63: | ||
Construction of {<barnase>} basic part K112504 | Construction of {<barnase>} basic part K112504 | ||
- | PCR CC007/CC008 on barnase gene ( | + | PCR CC007/CC008 on barnase gene ( 361 bp, EcoRI/BamHI) |
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | ||
Product is pBca1256-K112504 | Product is pBca1256-K112504 | ||
Line 70: | Line 70: | ||
CGATAgaattcATGaGATCTGCACAGG | CGATAgaattcATGaGATCTGCACAGG | ||
CC008 Reverse Biobricking of {<barnase>} | CC008 Reverse Biobricking of {<barnase>} | ||
- | + | CCAGTggatccTCTGATTTTTGTAAAGGTCTG | |
</pre> | </pre> | ||
Line 77: | Line 77: | ||
Construction of {<barnase!} basic part K112505 | Construction of {<barnase!} basic part K112505 | ||
- | PCR CC007/CC009 on barnase gene ( | + | PCR CC007/CC009 on barnase gene ( 364 bp, EcoRI/BamHI) |
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | ||
Product is pBca1256-K112505 | Product is pBca1256-K112505 | ||
Line 87: | Line 87: | ||
</pre> | </pre> | ||
- | == | + | ==K112232 (Molly's)== |
<pre> | <pre> | ||
- | Construction of { | + | Construction of {rbs.barstar!} Biobrick Part K112232 |
- | + | PCR mea035/mea034 on Bacillus amyloliquefaciens gen (320 bp, EcoRI/BamHI) | |
- | PCR mea035/mea034 on Bacillus amyloliquefaciens gen | + | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) |
- | Sub into pBca1256 | + | Product is pBca1256-K112232 |
- | Product is pBca1256- | + | |
---------------------------------------- | ---------------------------------------- | ||
- | mea035 | + | mea035 Forward Biobricking of {rbs.barstar!} |
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg | cgataGAATTCatgAGATCTcataagaaaggagccgcacatg | ||
- | mea034 | + | mea034 Reverse Biobricking of {rbs.barstar!} |
- | + | cgttaGGATCCttaagaaagtatgatggtgatgtcgcagcc | |
</pre> | </pre> | ||
+ | |||
+ | |||
+ | == K112233 (Molly's) == | ||
+ | <pre> | ||
+ | Construction of {<phoA>} Biobrick Part K112233 | ||
+ | PCR mea036/mea037 on pBca9145-Bca1126 (1219 bp, EcoRI/BamHI) | ||
+ | Sub into pBjh1601AC-Bca1144 (EcoRI/BamHI, 3195,910 L) | ||
+ | Product is pBjh1601AC-K112233 | ||
+ | ---------------------------------------- | ||
+ | mea036 Forward Biobricking of {<phoA>} cgatagaattcatgAGATCTGGAGATTCTG | ||
+ | mea037 Reverse Biobricking of {<phoA>} cgttaGGATCCCTTCAGGCCCAGCGCCGCTTTCATG | ||
+ | </pre> | ||
+ | |||
+ | |||
+ | == K112506 == | ||
+ | |||
+ | <pre> | ||
+ | Construction of {<HA>} basic part K112506 | ||
+ | |||
+ | Wobble PCR of cc001/cc010 ( 51 bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | ||
+ | Product is pBca1256-K112506 | ||
+ | -------------------------------------------- | ||
+ | cc001 Forward Biobricking of {<HA>} | ||
+ | CgATAgaattcATGagatcttacccatacgacgtcccagac | ||
+ | |||
+ | cc010 Reverse biobricking of {<HA>} | ||
+ | ccagtggatcccccagcgtagtctgggacgtcgtatggg | ||
+ | </pre> | ||
+ | |||
+ | |||
+ | == K112507 == | ||
+ | |||
+ | <pre> | ||
+ | Construction of {<HA!} basic part K112507 | ||
+ | |||
+ | Wobble PCR of cc001/cc011 ( 54 bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | ||
+ | Product is pBca1256-K112507 | ||
+ | -------------------------------------------- | ||
+ | cc001 Forward Biobricking of {<HA>} | ||
+ | CgATAgaattcATGagatcttacccatacgacgtcccagac | ||
+ | |||
+ | cc011 Reverse biobricking of {<HA!} | ||
+ | ccagtggatccttacccagcgtagtctgggacgtcgtatgggtaag | ||
+ | |||
+ | </pre> | ||
+ | |||
+ | |||
+ | -------------------------------------------------------------------------------------------------------------- | ||
+ | |||
+ | <div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Cici_Chen|Cici Chen]] </div> | ||
+ | <div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All notebook]] </div> |
Latest revision as of 01:58, 25 July 2008
Contents |
K112500
Construction of {<HA>} basic part K112500 Wobble PCR of cc001/cc002 ( 50 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112500 -------------------------------------------- cc001 Forward Biobricking of {<HA>} CgATAgaattcATGagatcttacccatacgacgtcccagac cc002 Reverse biobricking of {<HA>} ccagtggatccccagcgtagtctgggacgtcgtatggg
K112501
Construction of {<HA!} basic part K112501 Wobble PCR of cc001/cc003 ( 53 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112501 -------------------------------------------- cc001 Forward Biobricking of {<HA>} CgATAgaattcATGagatcttacccatacgacgtcccagac cc003 Reverse biobricking of {<HA!} ccagtggatccttaccagcgtagtctgggacgtcgtatgggtaag
K112502
Construction of {<myc>} basic part K112502 Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112502 -------------------------------------------- cc004 Forward Biobricking of {<myc>} CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG cc005 Reverse Biobricking of {<myc>} ccagtggatccCAGATCCTCTTCTGAGATGAGTTTTTG
K112503
Construction of {<myc!} basic part K112503 Wobble PCR of cc004/cc006 ( 54 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI,2227+ 910,L) Product is pBca1256-K112503 -------------------------------------------- cc004 Forward Biobricking of {<myc>} CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG cc006 Reverse Biobricking of {<myc!} ccagtggatccTTACAGATCCTCTTCTGAGATGAGTTTTTGTTC
K112504
Construction of {<barnase>} basic part K112504 PCR CC007/CC008 on barnase gene ( 361 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112504 -------------------------------------------- cc007 Forward Biobricking of {<barnase>} CGATAgaattcATGaGATCTGCACAGG CC008 Reverse Biobricking of {<barnase>} CCAGTggatccTCTGATTTTTGTAAAGGTCTG
K112505
Construction of {<barnase!} basic part K112505 PCR CC007/CC009 on barnase gene ( 364 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112505 -------------------------------------------- cc007 Forward Biobricking of {<barnase!} CGATAgaattcATGaGATCTGCACAGG CC009 Reverse Biobricking of {<barnase!} CCAGTggatcCTTATCTGATTTTTG
K112232 (Molly's)
Construction of {rbs.barstar!} Biobrick Part K112232 PCR mea035/mea034 on Bacillus amyloliquefaciens gen (320 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112232 ---------------------------------------- mea035 Forward Biobricking of {rbs.barstar!} cgataGAATTCatgAGATCTcataagaaaggagccgcacatg mea034 Reverse Biobricking of {rbs.barstar!} cgttaGGATCCttaagaaagtatgatggtgatgtcgcagcc
K112233 (Molly's)
Construction of {<phoA>} Biobrick Part K112233 PCR mea036/mea037 on pBca9145-Bca1126 (1219 bp, EcoRI/BamHI) Sub into pBjh1601AC-Bca1144 (EcoRI/BamHI, 3195,910 L) Product is pBjh1601AC-K112233 ---------------------------------------- mea036 Forward Biobricking of {<phoA>} cgatagaattcatgAGATCTGGAGATTCTG mea037 Reverse Biobricking of {<phoA>} cgttaGGATCCCTTCAGGCCCAGCGCCGCTTTCATG
K112506
Construction of {<HA>} basic part K112506 Wobble PCR of cc001/cc010 ( 51 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112506 -------------------------------------------- cc001 Forward Biobricking of {<HA>} CgATAgaattcATGagatcttacccatacgacgtcccagac cc010 Reverse biobricking of {<HA>} ccagtggatcccccagcgtagtctgggacgtcgtatggg
K112507
Construction of {<HA!} basic part K112507 Wobble PCR of cc001/cc011 ( 54 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112507 -------------------------------------------- cc001 Forward Biobricking of {<HA>} CgATAgaattcATGagatcttacccatacgacgtcccagac cc011 Reverse biobricking of {<HA!} ccagtggatccttacccagcgtagtctgggacgtcgtatgggtaag