Team:Paris/August 5

From 2008.igem.org

(Difference between revisions)
(→PCR Protocol)
Line 1: Line 1:
-
{{Paris/Calendar_Links|August 4|August 6}}
+
=== Electrophoresis Purification of PCR===
-
 
+
-
== '''Amplification of Promotors of interest (FliA, FliL, FlgA, FlgB, FlhB, FlhDC)'''==
+
-
 
+
-
''We performed PCR on to amplify the sequence in order to have enough amount of DNA to carry out the following of our experiments.''
+
-
 
+
-
 
+
-
=== '''PCR Protocol''' ===
+
-
 
+
-
* '''Preparation of the templates''' :--> Resuspend of 1 colony of MG1655 in 100µl of water.
+
-
 
+
-
 
+
-
* '''List of Oligos''' :
+
-
{|
+
-
|- style="background: #649CD7;"
+
-
|- style="background: #649CD7; text-align: center;"
+
-
|width=5%| Number
+
-
|width=10%| Name
+
-
|width=40%| Sequence
+
-
|width=5%| Length
+
-
|width=35%| Comments
+
-
|- style="background: #dddddd;" 
+
-
| style="background: #D4E2EF;" |O100
+
-
| FlgA-F
+
-
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGAGCATATCTCCTCCGCAGGTATCAAAAT
+
-
| 58
+
-
|
+
-
|- style="background: #dddddd;"
+
-
| style="background: #D4E2EF;" | O101
+
-
| FlgA-R
+
-
| GTTTCTTCCTGCAGCGGCCGCTACTAGTAACAGTATCGCGATGATCGCCACGCTACGT
+
-
| 58
+
-
|
+
-
|- style="background: #dddddd;"
+
-
| style="background: #D4E2EF;" | O102
+
-
| FlgB-F
+
-
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACAGTATCGCGATGATCGCCACGCTACG
+
-
| 58
+
-
|
+
-
|- style="background: #dddddd;"
+
-
| style="background: #D4E2EF;" | O103
+
-
| FlgB-R
+
-
| GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGCATATCTCCTCCGCAGGTATCAAAATT
+
-
| 58
+
-
|
+
-
|- style="background: #dddddd;"
+
-
| style="background: #D4E2EF;" | O108
+
-
| FlhB-F
+
-
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCCACGTCATATCAGGCGGTCTGATAAGG
+
-
| 58
+
-
|
+
-
|- style="background: #dddddd;"
+
-
| style="background: #D4E2EF;" | O109
+
-
| FlhB-R
+
-
| GTTTCTTCCTGCAGCGGCCGCTACTAGTAGTTTTGTCGTCGCTCTCGTCAGACACGTC
+
-
| 58
+
-
|
+
-
|- style="background: #dddddd;"
+
-
| style="background: #D4E2EF;" | O111
+
-
| FlhDC-Total-F
+
-
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCATTTTTGCTTGCTAGCGTACGGAAAA
+
-
| 58
+
-
|Amplify the both OmpR binding site
+
-
|- style="background: #dddddd;"
+
-
| style="background: #D4E2EF;" | O113
+
-
| FlhDC(nu)-R
+
-
| GTTTCTTCCTGCAGCGGCCGCTACTAGTACAGAATAACCAACTTTATTTTTATG
+
-
| 54
+
-
|Don't amplify the natural rbs of FlhD (only promoter)
+
-
|- style="background: #dddddd;"
+
-
| style="background: #D4E2EF;" | O124
+
-
| FliL-F
+
-
| GTTTCTTCGAATTCGCGGCCGCTTCTAGAGCAGCGAGAGGCTGTTGGTATTAATGACT
+
-
| 58
+
-
|
+
-
|- style="background: #dddddd;"
+
-
| style="background: #D4E2EF;" | O125
+
-
| FliL-R
+
-
| GTTTCTTCCTGCAGCGGCCGCTACTAGTACCAGCGATGAAATACTTGCCATGCGATTT
+
-
| 58
+
-
|
+
-
|}
+
-
 
+
-
 
+
-
 
+
-
* '''Preparation of PCR mix''' :
+
-
''For each samples,''
+
-
 
+
-
 
+
-
1 µl dNTP
+
-
<br>10 µl Buffer Phusion 5x
+
-
<br>2,5 µl Oligo_F
+
-
<br>2,5 µl Oligo_R
+
-
<br>1µl template
+
-
<br>1 µl Phusion
+
-
<br>50 µl qsp H2O (33µl)
+
-
 
+
-
 
+
-
* Program PCR: Annealing 55°C - Time élongation 1'30" - Number cycle : 29
+
-
 
+
-
=== Electrophoresis ===
+
''When the PCR cycles were finished,''
''When the PCR cycles were finished,''
Line 107: Line 7:
-
After electrophoresis, the bands corresponding to MP 100 and MP 120 were excised and purified using the QIAquick DNA Gel Extraction Kit (QIAGEN). The elution was made in 50 µL of water. Because the intensity of the band corresponding to MP 120 was very low, we only continued with MP 100. MP 100 was digested by EcoRI & SpeI (Forward Insert) or by XbaI & PstI (D100 : Backward Insert).
+
 
 +
After electrophoresis, the bands corresponding to the right amplification were excised and purified using the QIAquick DNA Gel Extraction Kit (QIAGEN). The elution was made in 50 µL of water. Because the intensity of the band corresponding to MP 120 was very low, we only continued with MP 100. MP 100 was digested by EcoRI & SpeI (Forward Insert) or by XbaI & PstI (D100 : Backward Insert).
[[Image:KR000102.jpg|thumb|]]
[[Image:KR000102.jpg|thumb|]]
Line 113: Line 14:
[[Image:KR000106.jpg|thumb|]]
[[Image:KR000106.jpg|thumb|]]
-
=== DNA Digestion ===
+
{|
-
 
+
|align="center"|Name
-
''Digestion reaction (total volume : 50 µL)''
+
|align="center"|Promotor
-
* 25 µL DNA
+
|align="center"|Gel
-
* 5 µL buffer 2 (10X)
+
|align="center"|Band
-
* 2 µL enzyme 1
+
|align="center"|Expected size
-
* 2 µL enzyme 2
+
|align="center"|Measured size
-
* 0.5 µL BSA (100X)
+
|-
-
* 15,5 µL water
+
|align="center"|PCR_124
-
 
+
|align="center"|pFlgA
-
* Incubate 2 hours at 37°C
+
|align="center"|
-
* The samples (2 x 30 µL per sample) were then analysed by electrophoresis.
+
|align="center"|
-
 
+
|align="center"|
-
 
+
|align="center"|
-
===Electrophoresis (bis)===
+
|-
-
 
+
|align="center"|PCR_125
-
 
+
|align="center"|pFlgB
-
The sequence of MP 100 (B0034) digested by EcoRI & SpeI (35 bp) or XbaI & PstI (34 bp) was too short and we didn't manage to visualise it on the gel.
+
|align="center"|
 +
|align="center"|
 +
|align="center"|
 +
|align="center"|
 +
|-
 +
|align="center"|PCR_126
 +
|align="center"|pFlhB
 +
|align="center"|
 +
|align="center"|
 +
|align="center"|
 +
|align="center"|
 +
|-
 +
|align="center"|PCR_127
 +
|align="center"|pFlhDC
 +
|align="center"|
 +
|align="center"|
 +
|align="center"|
 +
|align="center"|
 +
|}
-
Conclusion : small parts like B0034 can't be cloned as an insert.
+
==> '''Remark :'''

Revision as of 14:01, 6 August 2008

Electrophoresis Purification of PCR

When the PCR cycles were finished,

  • 10 µL of 6X loading dye were added
  • The samples were then loaded (2 x 30 µL per sample) on a 1,5% agarose gel.


After electrophoresis, the bands corresponding to the right amplification were excised and purified using the QIAquick DNA Gel Extraction Kit (QIAGEN). The elution was made in 50 µL of water. Because the intensity of the band corresponding to MP 120 was very low, we only continued with MP 100. MP 100 was digested by EcoRI & SpeI (Forward Insert) or by XbaI & PstI (D100 : Backward Insert).

KR000102.jpg
KR000104.jpg
KR000106.jpg
Name Promotor Gel Band Expected size Measured size
PCR_124 pFlgA
PCR_125 pFlgB
PCR_126 pFlhB
PCR_127 pFlhDC

==> Remark :

Retrieved from "http://2008.igem.org/Team:Paris/August_5"