"
Template:Team:UC Berkeley/Notebook/SC construction
From 2008.igem.org
(Difference between revisions)
| (9 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
| + | <span style="font-family: Century Gothic; font-size: 10pt"> | ||
| + | <div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div> | ||
| + | <div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div> | ||
__TOC__ | __TOC__ | ||
| Line 7: | Line 10: | ||
Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI) | Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI) | ||
| - | Sub into pBca1256 (EcoRI/BamHI, | + | Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) |
Product is pBca1256-K112600 | Product is pBca1256-K112600 | ||
---------------------------------------------------- | ---------------------------------------------------- | ||
| Line 21: | Line 24: | ||
Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI) | Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI) | ||
| - | Sub into pBca1256 (EcoRI/BamHI, | + | Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) |
Product is pBca1256-K112601 | Product is pBca1256-K112601 | ||
-------------------------------------------------- | -------------------------------------------------- | ||
| Line 35: | Line 38: | ||
Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI) | Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI) | ||
| - | Sub into pBca1256 (EcoRI/BamHI, | + | Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) |
Product is pBca1256-K112602 | Product is pBca1256-K112602 | ||
--------------------------------------------------- | --------------------------------------------------- | ||
| Line 49: | Line 52: | ||
Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI) | Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI) | ||
| - | Sub into pBca1256 (EcoRI/BamHI, | + | Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) |
Product is pBca1256-K112603 | Product is pBca1256-K112603 | ||
----------------------------------------------------- | ----------------------------------------------------- | ||
| Line 72: | Line 75: | ||
</pre> | </pre> | ||
| - | == | + | == pBjh1601AC-K112403 == |
<pre> | <pre> | ||
Construction of {PhoA>} basic part K112403 | Construction of {PhoA>} basic part K112403 | ||
CR cb10007/cb10008 on MG1655 (95 bp, EcoRI/BamHI) | CR cb10007/cb10008 on MG1655 (95 bp, EcoRI/BamHI) | ||
| - | Sub into | + | Sub into pBjh1601AC (EcoRI/BamHI, 3195+910 L) |
| - | Product is | + | Product is pBjh1601AC-K112403 |
------------------------------------------------------------- | ------------------------------------------------------------- | ||
cb10007 Fwd biobricking of {prepro>} | cb10007 Fwd biobricking of {prepro>} | ||
| Line 86: | Line 89: | ||
</pre> | </pre> | ||
| - | == | + | == pBjh1601AC-K112404 == |
<pre> | <pre> | ||
Construction of {LamB>} basic part K112404 | Construction of {LamB>} basic part K112404 | ||
PCR cb10009/cb10010 on MG1655 (107 bp, EcoRI/BamHI) | PCR cb10009/cb10010 on MG1655 (107 bp, EcoRI/BamHI) | ||
| - | Sub into | + | Sub into pBjh1601AC (EcoRI/BamHI, 3195+910, L) |
| - | Product is | + | Product is pBjh1601AC-K112404 |
------------------------------------------------------------- | ------------------------------------------------------------- | ||
cb10009 Fwd biobricking of {prepro>} | cb10009 Fwd biobricking of {prepro>} | ||
| Line 100: | Line 103: | ||
</pre> | </pre> | ||
| - | == | + | == pBjh1601KC-K112605 == |
<pre> | <pre> | ||
Construction of {a~PhoA>} basic part K112605 | Construction of {a~PhoA>} basic part K112605 | ||
PCR sc008/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI) | PCR sc008/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI) | ||
| - | Sub into | + | Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L) |
| - | Product is | + | Product is pBjh1601KC-K112605 |
------------------------------------------------------ | ------------------------------------------------------ | ||
sc008 Fwd biobricking of {a~prepro>} | sc008 Fwd biobricking of {a~prepro>} | ||
| Line 114: | Line 117: | ||
</pre> | </pre> | ||
| - | == | + | == pBjh1601CK-K112606 == |
<pre> | <pre> | ||
Construction of {a~LamB>} basic part K112606 | Construction of {a~LamB>} basic part K112606 | ||
PCR sc009/cb10010-lamB-R on MG1655 (111 bp, EcoRI/BamHI) | PCR sc009/cb10010-lamB-R on MG1655 (111 bp, EcoRI/BamHI) | ||
| - | Sub into | + | Sub into pBjh1601CK (EcoRI/BamHI, 3134+910, L) |
| - | Product is | + | Product is pBjh1601CK-K112606 |
-------------------------------------------------- | -------------------------------------------------- | ||
sc009 Fwd biobricking of {a~prepro>} | sc009 Fwd biobricking of {a~prepro>} | ||
| Line 128: | Line 131: | ||
</pre> | </pre> | ||
| - | == | + | == pBjh1601KC-K112607 == |
<pre> | <pre> | ||
Construction of {rbs_PhoA>} basic part K112607 | Construction of {rbs_PhoA>} basic part K112607 | ||
PCR sc010/cb10008-PhoA-R on MG1655 (113 bp, EcoRI/BamHI) | PCR sc010/cb10008-PhoA-R on MG1655 (113 bp, EcoRI/BamHI) | ||
| - | Sub into | + | Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L) |
| - | Product is | + | Product is pBjh1601KC-K112607 |
------------------------------------------------------ | ------------------------------------------------------ | ||
sc010 Fwd biobricking of {rbs_prepro>} | sc010 Fwd biobricking of {rbs_prepro>} | ||
| Line 142: | Line 145: | ||
</pre> | </pre> | ||
| - | == | + | == pBjh1601KC-K112608 == |
<pre> | <pre> | ||
Construction of {rbs_LamB>} basic part K112608 | Construction of {rbs_LamB>} basic part K112608 | ||
PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (126 bp, EcoRI/BamHI) | PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (126 bp, EcoRI/BamHI) | ||
| - | Sub into | + | Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L) |
| - | Product is | + | Product is pBjh1601KC-K112608 |
------------------------------------------------------ | ------------------------------------------------------ | ||
sc011 Fwd biobricking of {rbs_prepro>} | sc011 Fwd biobricking of {rbs_prepro>} | ||
| Line 156: | Line 159: | ||
</pre> | </pre> | ||
| - | == | + | == pBjh1601CA-K112609 == |
<pre> | <pre> | ||
Construction of {a~PhoA>} basic part K112609 (K112605 replacement) | Construction of {a~PhoA>} basic part K112609 (K112605 replacement) | ||
PCR sc012/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI) | PCR sc012/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI) | ||
| - | Sub into | + | Sub into pBjh1601CA (EcoRI/BamHI, 2472+910, L) |
| - | Product is | + | Product is pBjh1601CA-K112605 |
------------------------------------------------------ | ------------------------------------------------------ | ||
sc012 Fwd biobricking of {a~prepro>} | sc012 Fwd biobricking of {a~prepro>} | ||
| Line 198: | Line 201: | ||
cgataGAATTCatgAGATCTatgatgattactctgcgcaaac | cgataGAATTCatgAGATCTatgatgattactctgcgcaaac | ||
sc014 Reverse biobricking of {prepro>} | sc014 Reverse biobricking of {prepro>} | ||
| - | + | ccagtGGATCCagccattgcctgagcagac | |
</pre> | </pre> | ||
| Line 212: | Line 215: | ||
cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcactggc | cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcactggc | ||
sc013 Reverse biobricking of {prepro>} | sc013 Reverse biobricking of {prepro>} | ||
| - | ccagtGGATCCggcttttgtcacaggggtaaac | + | ccagtGGATCCggcttttgtcacaggggtaaac |
</pre> | </pre> | ||
| Line 226: | Line 229: | ||
cgataGAATTCatgAGATCTtagaatgatgattactctgcgc | cgataGAATTCatgAGATCTtagaatgatgattactctgcgc | ||
sc014 Reverse biobricking of {prepro>} | sc014 Reverse biobricking of {prepro>} | ||
| - | + | ccagtGGATCCagccattgcctgagcagac | |
</pre> | </pre> | ||
| Line 240: | Line 243: | ||
cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac | cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac | ||
sc013 Reverse biobricking of {prepro>} | sc013 Reverse biobricking of {prepro>} | ||
| - | ccagtGGATCCggcttttgtcacaggggtaaac | + | ccagtGGATCCggcttttgtcacaggggtaaac |
</pre> | </pre> | ||
| Line 254: | Line 257: | ||
cgataGAATTCatgAGATCTcaatgactcaggagatagaatg | cgataGAATTCatgAGATCTcaatgactcaggagatagaatg | ||
sc014 Reverse biobricking of {prepro>} | sc014 Reverse biobricking of {prepro>} | ||
| - | + | ccagtGGATCCagccattgcctgagcagac | |
</pre> | </pre> | ||
| - | + | == pBca1102-Bca9194 Assembly part == | |
| + | <pre> | ||
| + | PCR ca998/mea037 on Bca9194 (1610 bp, EcoRI/BamHI?) | ||
| + | Sub into {<tag!}.{b1006} composite part (CK vector) (EcoRI/BamHI,____+__) | ||
| + | Product is _______________ | ||
| + | --------------------------------------------------------- | ||
| + | ca998 Fwd biobricking | ||
| + | gtatcacgaggcagaatttcag | ||
| + | mea037 Reverse biobricking of {<phoA>} | ||
| + | cgttaGGATCCCTTCAGGCCCAGCGCCGCTTTCATG | ||
| + | </pre> | ||
---- | ---- | ||
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div> | <div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div> | ||
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div> | <div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div> | ||
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div> | <div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div> | ||
Latest revision as of 20:23, 8 August 2008
pBca1256-K112600
Construction of {<AP>} basic part K112600
Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+ 910)
Product is pBca1256-K112600
----------------------------------------------------
SC001F Forward Biobricking of <AP-tag>
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag
SC002R Reverse Biobricking of <AP-tag>
ccagtGGATCCttcatgccattcaattttctgcgcttcaaaaatatcg
pBca1256-K112601
Construction of {<AP!} basic part K112601
Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+ 910)
Product is pBca1256-K112601
--------------------------------------------------
SC001 Forward Biobricking of <AP-tag!
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag
SC003 Reverse Biobricking of <AP-tag!
ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg
pBca1256-K112602
Construction of {<FLAG>} basic part K112602
Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+ 910)
Product is pBca1256-K112602
---------------------------------------------------
SC004 Forward Biobricking of <FLAG-tag>
cgataGAATTCatgAGATCTgactacaaggatgacgacg
SC005 Reverse Biobricking of <FLAG-tag>
ccagtGGATCCcttgtcgtcgtcatccttgtagtc
pBca1256-K112603
Construction of {<FLAG!} basic part K112603
Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+ 910)
Product is pBca1256-K112603
-----------------------------------------------------
SC004 Forward Biobricking of <FLAG-tag!
cgataGAATTCatgAGATCTgactacaaggatgacgacg
SC006 Reverse Biobricking of <FLAG-tag!
ccagtGGATCCttacttgtcgtcgtcatccttgtagtc
pBca1256-K112604
Construction of {rbs_barstar>} basic part K112604
PCR mea035/sc007 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)
Product is pBca1256-K112604
-------------------------------
mea035 Fwd biobricking of {rbs_barstar>}
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg
sc007 Reverse biobricking of {rbs_barstar>} (Not needed...)
cgttaGGATCCagaaagtatgatggtgatgtcgc
pBjh1601AC-K112403
Construction of {PhoA>} basic part K112403
CR cb10007/cb10008 on MG1655 (95 bp, EcoRI/BamHI)
Sub into pBjh1601AC (EcoRI/BamHI, 3195+910 L)
Product is pBjh1601AC-K112403
-------------------------------------------------------------
cb10007 Fwd biobricking of {prepro>}
cgataGAATTCatgAGATCTatgaaacaaagcactattgcactggc
cb10008 Reverse biobricking of {prepro>}
cgtagGGATCCgggcttttgtcacaggggtaaac
pBjh1601AC-K112404
Construction of {LamB>} basic part K112404
PCR cb10009/cb10010 on MG1655 (107 bp, EcoRI/BamHI)
Sub into pBjh1601AC (EcoRI/BamHI, 3195+910, L)
Product is pBjh1601AC-K112404
-------------------------------------------------------------
cb10009 Fwd biobricking of {prepro>}
cgataGAATTCatgAGATCTatgatgattactctgcgcaaac
cb10010 Reverse biobricking of {prepro>}
cgtagGGATCCcagccattgcctgagcagacattac
pBjh1601KC-K112605
Construction of {a~PhoA>} basic part K112605
PCR sc008/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI)
Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L)
Product is pBjh1601KC-K112605
------------------------------------------------------
sc008 Fwd biobricking of {a~prepro>}
cgataGAATTCatgAGATCTtaaaGtgaaacaaagcactattgcactggc
cb10008 Reverse biobricking of {a~prepro>}
cgtagGGATCCgggcttttgtcacaggggtaaac
pBjh1601CK-K112606
Construction of {a~LamB>} basic part K112606
PCR sc009/cb10010-lamB-R on MG1655 (111 bp, EcoRI/BamHI)
Sub into pBjh1601CK (EcoRI/BamHI, 3134+910, L)
Product is pBjh1601CK-K112606
--------------------------------------------------
sc009 Fwd biobricking of {a~prepro>}
cgataGAATTCatgAGATCTtagaatgatgattactctgcgc
cb10010 Reverse biobricking of {a~prepro>}
cgtagGGATCCcagccattgcctgagcagacattac
pBjh1601KC-K112607
Construction of {rbs_PhoA>} basic part K112607
PCR sc010/cb10008-PhoA-R on MG1655 (113 bp, EcoRI/BamHI)
Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L)
Product is pBjh1601KC-K112607
------------------------------------------------------
sc010 Fwd biobricking of {rbs_prepro>}
cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac
cb10008 Reverse biobricking of {rbs_prepro>}
cgtagGGATCCgggcttttgtcacaggggtaaac
pBjh1601KC-K112608
Construction of {rbs_LamB>} basic part K112608
PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (126 bp, EcoRI/BamHI)
Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L)
Product is pBjh1601KC-K112608
------------------------------------------------------
sc011 Fwd biobricking of {rbs_prepro>}
cgataGAATTCatgAGATCTcaatgactcaggagatagaatg
cb10010 Reverse biobricking of {rbs_prepro>}
cgtagGGATCCcagccattgcctgagcagacattac
pBjh1601CA-K112609
Construction of {a~PhoA>} basic part K112609 (K112605 replacement)
PCR sc012/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI)
Sub into pBjh1601CA (EcoRI/BamHI, 2472+910, L)
Product is pBjh1601CA-K112605
------------------------------------------------------
sc012 Fwd biobricking of {a~prepro>}
cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcactggc
cb10008 Reverse biobricking of {a~prepro>}
cgtagGGATCCgggcttttgtcacaggggtaaac
pBca1256-K112610
Construction of {PhoA>} basic part K112610
PCR cb10007/sc013 on MG1655 (94 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)
Product is pBca1256-K112610
------------------------------------------------------
cb10007 Fwd biobricking of {prepro>}
cgataGAATTCatgAGATCTatgaaacaaagcactattgcactggc
sc013 Reverse biobricking of {prepro>}
ccagtGGATCCggcttttgtcacaggggtaaac
pBca1256-K112611
Construction of {LamB>} basic part K112611
PCR cb10009/sc014 on MG1655 (107 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)
Product is pBca1256-K112605
------------------------------------------------------
cb10009 Fwd biobricking of {prepro>}
cgataGAATTCatgAGATCTatgatgattactctgcgcaaac
sc014 Reverse biobricking of {prepro>}
ccagtGGATCCagccattgcctgagcagac
pBca1256-K112612
Construction of {a~PhoA>} basic part K112612
PCR sc012/sc013 on MG1655 (98 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)
Product is pBca1256-K112605
------------------------------------------------------
sc012 Fwd biobricking of {a~prepro>}
cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcactggc
sc013 Reverse biobricking of {prepro>}
ccagtGGATCCggcttttgtcacaggggtaaac
pBca1256-K112613
Construction of {a~LamB>} basic part K112613
PCR sc009/sc014 on MG1655 (111 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)
Product is pBca1256-K112605
------------------------------------------------------
sc009 Fwd biobricking of {a~prepro>}
cgataGAATTCatgAGATCTtagaatgatgattactctgcgc
sc014 Reverse biobricking of {prepro>}
ccagtGGATCCagccattgcctgagcagac
pBca1256-K112614
Construction of {rbs_PhoA>} basic part K112614
PCR sc010/sc013 on MG1655 (112 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)
Product is pBca1256-K112605
------------------------------------------------------
sc010 Fwd biobricking of {rbs_prepro>}
cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac
sc013 Reverse biobricking of {prepro>}
ccagtGGATCCggcttttgtcacaggggtaaac
pBca1256-K112615
Construction of {rbs_LamB>} basic part K112615
PCR sc011/sc014 on MG1655 (126 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)
Product is pBca1256-K112605
------------------------------------------------------
sc011 Fwd biobricking of {rbs_prepro>}
cgataGAATTCatgAGATCTcaatgactcaggagatagaatg
sc014 Reverse biobricking of {prepro>}
ccagtGGATCCagccattgcctgagcagac
pBca1102-Bca9194 Assembly part
PCR ca998/mea037 on Bca9194 (1610 bp, EcoRI/BamHI?)
Sub into {<tag!}.{b1006} composite part (CK vector) (EcoRI/BamHI,____+__)
Product is _______________
---------------------------------------------------------
ca998 Fwd biobricking
gtatcacgaggcagaatttcag
mea037 Reverse biobricking of {<phoA>}
cgttaGGATCCCTTCAGGCCCAGCGCCGCTTTCATG
