Template:Team:UC Berkeley/Notebook/SC construction
From 2008.igem.org
(Difference between revisions)
(46 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
+ | <span style="font-family: Century Gothic; font-size: 10pt"> | ||
+ | <div style="text-align: right;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Back to Sherine's Notebook]] </div> | ||
+ | <div style="text-align: right;"> [[Team:UC_Berkeley/Notebook| To All Notebooks]] </div> | ||
__TOC__ | __TOC__ | ||
Line 4: | Line 7: | ||
== pBca1256-K112600 == | == pBca1256-K112600 == | ||
<pre> | <pre> | ||
- | Construction of <AP | + | Construction of {<AP>} basic part K112600 |
- | Wobble PCR SC001/SC002 | + | Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI) |
- | Sub into pBca1256 | + | Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) |
Product is pBca1256-K112600 | Product is pBca1256-K112600 | ||
---------------------------------------------------- | ---------------------------------------------------- | ||
Line 18: | Line 21: | ||
== pBca1256-K112601 == | == pBca1256-K112601 == | ||
<pre> | <pre> | ||
- | Construction of <AP | + | Construction of {<AP!} basic part K112601 |
- | Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI) | + | Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI) |
- | Sub into pBca1256 | + | Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) |
Product is pBca1256-K112601 | Product is pBca1256-K112601 | ||
-------------------------------------------------- | -------------------------------------------------- | ||
- | SC001 | + | SC001 Forward Biobricking of <AP-tag! |
cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag | cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag | ||
- | SC003 | + | SC003 Reverse Biobricking of <AP-tag! |
ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg | ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg | ||
</pre> | </pre> | ||
Line 32: | Line 35: | ||
== pBca1256-K112602 == | == pBca1256-K112602 == | ||
<pre> | <pre> | ||
- | Construction of <FLAG | + | Construction of {<FLAG>} basic part K112602 |
- | Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI) | + | Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI) |
- | Sub into pBca1256 | + | Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) |
Product is pBca1256-K112602 | Product is pBca1256-K112602 | ||
- | + | --------------------------------------------------- | |
SC004 Forward Biobricking of <FLAG-tag> | SC004 Forward Biobricking of <FLAG-tag> | ||
cgataGAATTCatgAGATCTgactacaaggatgacgacg | cgataGAATTCatgAGATCTgactacaaggatgacgacg | ||
Line 46: | Line 49: | ||
== pBca1256-K112603 == | == pBca1256-K112603 == | ||
<pre> | <pre> | ||
- | Construction of <FLAG | + | Construction of {<FLAG!} basic part K112603 |
- | Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI) | + | Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI) |
- | Sub into pBca1256 | + | Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) |
Product is pBca1256-K112603 | Product is pBca1256-K112603 | ||
- | + | ----------------------------------------------------- | |
- | SC004 | + | SC004 Forward Biobricking of <FLAG-tag! |
cgataGAATTCatgAGATCTgactacaaggatgacgacg | cgataGAATTCatgAGATCTgactacaaggatgacgacg | ||
- | SC006 | + | SC006 Reverse Biobricking of <FLAG-tag! |
ccagtGGATCCttacttgtcgtcgtcatccttgtagtc | ccagtGGATCCttacttgtcgtcgtcatccttgtagtc | ||
</pre> | </pre> | ||
+ | == pBca1256-K112604 == | ||
+ | <pre> | ||
+ | Construction of {rbs_barstar>} basic part K112604 | ||
+ | PCR mea035/sc007 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) | ||
+ | Product is pBca1256-K112604 | ||
+ | ------------------------------- | ||
+ | mea035 Fwd biobricking of {rbs_barstar>} | ||
+ | cgataGAATTCatgAGATCTcataagaaaggagccgcacatg | ||
+ | sc007 Reverse biobricking of {rbs_barstar>} (Not needed...) | ||
+ | cgttaGGATCCagaaagtatgatggtgatgtcgc | ||
+ | </pre> | ||
+ | == pBjh1601AC-K112403 == | ||
+ | <pre> | ||
+ | Construction of {PhoA>} basic part K112403 | ||
+ | |||
+ | CR cb10007/cb10008 on MG1655 (95 bp, EcoRI/BamHI) | ||
+ | Sub into pBjh1601AC (EcoRI/BamHI, 3195+910 L) | ||
+ | Product is pBjh1601AC-K112403 | ||
+ | ------------------------------------------------------------- | ||
+ | cb10007 Fwd biobricking of {prepro>} | ||
+ | cgataGAATTCatgAGATCTatgaaacaaagcactattgcactggc | ||
+ | cb10008 Reverse biobricking of {prepro>} | ||
+ | cgtagGGATCCgggcttttgtcacaggggtaaac | ||
+ | </pre> | ||
+ | |||
+ | == pBjh1601AC-K112404 == | ||
+ | <pre> | ||
+ | Construction of {LamB>} basic part K112404 | ||
+ | |||
+ | PCR cb10009/cb10010 on MG1655 (107 bp, EcoRI/BamHI) | ||
+ | Sub into pBjh1601AC (EcoRI/BamHI, 3195+910, L) | ||
+ | Product is pBjh1601AC-K112404 | ||
+ | ------------------------------------------------------------- | ||
+ | cb10009 Fwd biobricking of {prepro>} | ||
+ | cgataGAATTCatgAGATCTatgatgattactctgcgcaaac | ||
+ | cb10010 Reverse biobricking of {prepro>} | ||
+ | cgtagGGATCCcagccattgcctgagcagacattac | ||
+ | </pre> | ||
+ | |||
+ | == pBjh1601KC-K112605 == | ||
+ | <pre> | ||
+ | Construction of {a~PhoA>} basic part K112605 | ||
+ | |||
+ | PCR sc008/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI) | ||
+ | Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L) | ||
+ | Product is pBjh1601KC-K112605 | ||
+ | ------------------------------------------------------ | ||
+ | sc008 Fwd biobricking of {a~prepro>} | ||
+ | cgataGAATTCatgAGATCTtaaaGtgaaacaaagcactattgcactggc | ||
+ | cb10008 Reverse biobricking of {a~prepro>} | ||
+ | cgtagGGATCCgggcttttgtcacaggggtaaac | ||
+ | </pre> | ||
+ | |||
+ | == pBjh1601CK-K112606 == | ||
+ | <pre> | ||
+ | Construction of {a~LamB>} basic part K112606 | ||
+ | |||
+ | PCR sc009/cb10010-lamB-R on MG1655 (111 bp, EcoRI/BamHI) | ||
+ | Sub into pBjh1601CK (EcoRI/BamHI, 3134+910, L) | ||
+ | Product is pBjh1601CK-K112606 | ||
+ | -------------------------------------------------- | ||
+ | sc009 Fwd biobricking of {a~prepro>} | ||
+ | cgataGAATTCatgAGATCTtagaatgatgattactctgcgc | ||
+ | cb10010 Reverse biobricking of {a~prepro>} | ||
+ | cgtagGGATCCcagccattgcctgagcagacattac | ||
+ | </pre> | ||
+ | |||
+ | == pBjh1601KC-K112607 == | ||
+ | <pre> | ||
+ | Construction of {rbs_PhoA>} basic part K112607 | ||
+ | |||
+ | PCR sc010/cb10008-PhoA-R on MG1655 (113 bp, EcoRI/BamHI) | ||
+ | Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L) | ||
+ | Product is pBjh1601KC-K112607 | ||
+ | ------------------------------------------------------ | ||
+ | sc010 Fwd biobricking of {rbs_prepro>} | ||
+ | cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac | ||
+ | cb10008 Reverse biobricking of {rbs_prepro>} | ||
+ | cgtagGGATCCgggcttttgtcacaggggtaaac | ||
+ | </pre> | ||
+ | |||
+ | == pBjh1601KC-K112608 == | ||
+ | <pre> | ||
+ | Construction of {rbs_LamB>} basic part K112608 | ||
+ | |||
+ | PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (126 bp, EcoRI/BamHI) | ||
+ | Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L) | ||
+ | Product is pBjh1601KC-K112608 | ||
+ | ------------------------------------------------------ | ||
+ | sc011 Fwd biobricking of {rbs_prepro>} | ||
+ | cgataGAATTCatgAGATCTcaatgactcaggagatagaatg | ||
+ | cb10010 Reverse biobricking of {rbs_prepro>} | ||
+ | cgtagGGATCCcagccattgcctgagcagacattac | ||
+ | </pre> | ||
+ | |||
+ | == pBjh1601CA-K112609 == | ||
+ | <pre> | ||
+ | Construction of {a~PhoA>} basic part K112609 (K112605 replacement) | ||
+ | |||
+ | PCR sc012/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI) | ||
+ | Sub into pBjh1601CA (EcoRI/BamHI, 2472+910, L) | ||
+ | Product is pBjh1601CA-K112605 | ||
+ | ------------------------------------------------------ | ||
+ | sc012 Fwd biobricking of {a~prepro>} | ||
+ | cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcactggc | ||
+ | cb10008 Reverse biobricking of {a~prepro>} | ||
+ | cgtagGGATCCgggcttttgtcacaggggtaaac | ||
+ | </pre> | ||
+ | |||
+ | --------------------------------------------------------------------------------------------------------------- | ||
+ | |||
+ | |||
+ | == pBca1256-K112610 == | ||
+ | <pre> | ||
+ | Construction of {PhoA>} basic part K112610 | ||
+ | |||
+ | PCR cb10007/sc013 on MG1655 (94 bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) | ||
+ | Product is pBca1256-K112610 | ||
+ | ------------------------------------------------------ | ||
+ | cb10007 Fwd biobricking of {prepro>} | ||
+ | cgataGAATTCatgAGATCTatgaaacaaagcactattgcactggc | ||
+ | sc013 Reverse biobricking of {prepro>} | ||
+ | ccagtGGATCCggcttttgtcacaggggtaaac | ||
+ | </pre> | ||
+ | |||
+ | == pBca1256-K112611 == | ||
+ | <pre> | ||
+ | Construction of {LamB>} basic part K112611 | ||
+ | |||
+ | PCR cb10009/sc014 on MG1655 (107 bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) | ||
+ | Product is pBca1256-K112605 | ||
+ | ------------------------------------------------------ | ||
+ | cb10009 Fwd biobricking of {prepro>} | ||
+ | cgataGAATTCatgAGATCTatgatgattactctgcgcaaac | ||
+ | sc014 Reverse biobricking of {prepro>} | ||
+ | ccagtGGATCCagccattgcctgagcagac | ||
+ | </pre> | ||
+ | |||
+ | == pBca1256-K112612 == | ||
+ | <pre> | ||
+ | Construction of {a~PhoA>} basic part K112612 | ||
+ | |||
+ | PCR sc012/sc013 on MG1655 (98 bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) | ||
+ | Product is pBca1256-K112605 | ||
+ | ------------------------------------------------------ | ||
+ | sc012 Fwd biobricking of {a~prepro>} | ||
+ | cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcactggc | ||
+ | sc013 Reverse biobricking of {prepro>} | ||
+ | ccagtGGATCCggcttttgtcacaggggtaaac | ||
+ | </pre> | ||
+ | |||
+ | == pBca1256-K112613 == | ||
+ | <pre> | ||
+ | Construction of {a~LamB>} basic part K112613 | ||
+ | |||
+ | PCR sc009/sc014 on MG1655 (111 bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) | ||
+ | Product is pBca1256-K112605 | ||
+ | ------------------------------------------------------ | ||
+ | sc009 Fwd biobricking of {a~prepro>} | ||
+ | cgataGAATTCatgAGATCTtagaatgatgattactctgcgc | ||
+ | sc014 Reverse biobricking of {prepro>} | ||
+ | ccagtGGATCCagccattgcctgagcagac | ||
+ | </pre> | ||
+ | |||
+ | == pBca1256-K112614 == | ||
+ | <pre> | ||
+ | Construction of {rbs_PhoA>} basic part K112614 | ||
+ | |||
+ | PCR sc010/sc013 on MG1655 (112 bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) | ||
+ | Product is pBca1256-K112605 | ||
+ | ------------------------------------------------------ | ||
+ | sc010 Fwd biobricking of {rbs_prepro>} | ||
+ | cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac | ||
+ | sc013 Reverse biobricking of {prepro>} | ||
+ | ccagtGGATCCggcttttgtcacaggggtaaac | ||
+ | </pre> | ||
+ | |||
+ | == pBca1256-K112615 == | ||
+ | <pre> | ||
+ | Construction of {rbs_LamB>} basic part K112615 | ||
+ | |||
+ | PCR sc011/sc014 on MG1655 (126 bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) | ||
+ | Product is pBca1256-K112605 | ||
+ | ------------------------------------------------------ | ||
+ | sc011 Fwd biobricking of {rbs_prepro>} | ||
+ | cgataGAATTCatgAGATCTcaatgactcaggagatagaatg | ||
+ | sc014 Reverse biobricking of {prepro>} | ||
+ | ccagtGGATCCagccattgcctgagcagac | ||
+ | </pre> | ||
+ | |||
+ | == pBca1102-Bca9194 Assembly part == | ||
+ | <pre> | ||
+ | PCR ca998/mea037 on Bca9194 (1610 bp, EcoRI/BamHI?) | ||
+ | Sub into {<tag!}.{b1006} composite part (CK vector) (EcoRI/BamHI,____+__) | ||
+ | Product is _______________ | ||
+ | --------------------------------------------------------- | ||
+ | ca998 Fwd biobricking | ||
+ | gtatcacgaggcagaatttcag | ||
+ | mea037 Reverse biobricking of {<phoA>} | ||
+ | cgttaGGATCCCTTCAGGCCCAGCGCCGCTTTCATG | ||
+ | </pre> | ||
---- | ---- | ||
<div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div> | <div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Sherine_Cheung|Sherine Cheung]] </div> | ||
<div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div> | <div style="text-align: center;"> [[Team:UC_Berkeley|Back to Berkeley Team Homepage]] </div> | ||
+ | <div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All Notebooks]] </div> |
Latest revision as of 20:23, 8 August 2008
pBca1256-K112600
Construction of {<AP>} basic part K112600 Wobble PCR SC001/SC002 (66 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) Product is pBca1256-K112600 ---------------------------------------------------- SC001F Forward Biobricking of <AP-tag> cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag SC002R Reverse Biobricking of <AP-tag> ccagtGGATCCttcatgccattcaattttctgcgcttcaaaaatatcg
pBca1256-K112601
Construction of {<AP!} basic part K112601 Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) Product is pBca1256-K112601 -------------------------------------------------- SC001 Forward Biobricking of <AP-tag! cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag SC003 Reverse Biobricking of <AP-tag! ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg
pBca1256-K112602
Construction of {<FLAG>} basic part K112602 Wobble PCR SC004/SC005 (45 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) Product is pBca1256-K112602 --------------------------------------------------- SC004 Forward Biobricking of <FLAG-tag> cgataGAATTCatgAGATCTgactacaaggatgacgacg SC005 Reverse Biobricking of <FLAG-tag> ccagtGGATCCcttgtcgtcgtcatccttgtagtc
pBca1256-K112603
Construction of {<FLAG!} basic part K112603 Wobble PCR SC004/SC006 (48 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) Product is pBca1256-K112603 ----------------------------------------------------- SC004 Forward Biobricking of <FLAG-tag! cgataGAATTCatgAGATCTgactacaaggatgacgacg SC006 Reverse Biobricking of <FLAG-tag! ccagtGGATCCttacttgtcgtcgtcatccttgtagtc
pBca1256-K112604
Construction of {rbs_barstar>} basic part K112604 PCR mea035/sc007 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112604 ------------------------------- mea035 Fwd biobricking of {rbs_barstar>} cgataGAATTCatgAGATCTcataagaaaggagccgcacatg sc007 Reverse biobricking of {rbs_barstar>} (Not needed...) cgttaGGATCCagaaagtatgatggtgatgtcgc
pBjh1601AC-K112403
Construction of {PhoA>} basic part K112403 CR cb10007/cb10008 on MG1655 (95 bp, EcoRI/BamHI) Sub into pBjh1601AC (EcoRI/BamHI, 3195+910 L) Product is pBjh1601AC-K112403 ------------------------------------------------------------- cb10007 Fwd biobricking of {prepro>} cgataGAATTCatgAGATCTatgaaacaaagcactattgcactggc cb10008 Reverse biobricking of {prepro>} cgtagGGATCCgggcttttgtcacaggggtaaac
pBjh1601AC-K112404
Construction of {LamB>} basic part K112404 PCR cb10009/cb10010 on MG1655 (107 bp, EcoRI/BamHI) Sub into pBjh1601AC (EcoRI/BamHI, 3195+910, L) Product is pBjh1601AC-K112404 ------------------------------------------------------------- cb10009 Fwd biobricking of {prepro>} cgataGAATTCatgAGATCTatgatgattactctgcgcaaac cb10010 Reverse biobricking of {prepro>} cgtagGGATCCcagccattgcctgagcagacattac
pBjh1601KC-K112605
Construction of {a~PhoA>} basic part K112605 PCR sc008/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI) Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L) Product is pBjh1601KC-K112605 ------------------------------------------------------ sc008 Fwd biobricking of {a~prepro>} cgataGAATTCatgAGATCTtaaaGtgaaacaaagcactattgcactggc cb10008 Reverse biobricking of {a~prepro>} cgtagGGATCCgggcttttgtcacaggggtaaac
pBjh1601CK-K112606
Construction of {a~LamB>} basic part K112606 PCR sc009/cb10010-lamB-R on MG1655 (111 bp, EcoRI/BamHI) Sub into pBjh1601CK (EcoRI/BamHI, 3134+910, L) Product is pBjh1601CK-K112606 -------------------------------------------------- sc009 Fwd biobricking of {a~prepro>} cgataGAATTCatgAGATCTtagaatgatgattactctgcgc cb10010 Reverse biobricking of {a~prepro>} cgtagGGATCCcagccattgcctgagcagacattac
pBjh1601KC-K112607
Construction of {rbs_PhoA>} basic part K112607 PCR sc010/cb10008-PhoA-R on MG1655 (113 bp, EcoRI/BamHI) Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L) Product is pBjh1601KC-K112607 ------------------------------------------------------ sc010 Fwd biobricking of {rbs_prepro>} cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac cb10008 Reverse biobricking of {rbs_prepro>} cgtagGGATCCgggcttttgtcacaggggtaaac
pBjh1601KC-K112608
Construction of {rbs_LamB>} basic part K112608 PCR sc011/cb10010-lamB-R on E.coli K12 MG1655 (126 bp, EcoRI/BamHI) Sub into pBjh1601KC (EcoRI/BamHI, 3132+910, L) Product is pBjh1601KC-K112608 ------------------------------------------------------ sc011 Fwd biobricking of {rbs_prepro>} cgataGAATTCatgAGATCTcaatgactcaggagatagaatg cb10010 Reverse biobricking of {rbs_prepro>} cgtagGGATCCcagccattgcctgagcagacattac
pBjh1601CA-K112609
Construction of {a~PhoA>} basic part K112609 (K112605 replacement) PCR sc012/cb10008-phoA-R on MG1655 (100 bp, EcoRI/BamHI) Sub into pBjh1601CA (EcoRI/BamHI, 2472+910, L) Product is pBjh1601CA-K112605 ------------------------------------------------------ sc012 Fwd biobricking of {a~prepro>} cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcactggc cb10008 Reverse biobricking of {a~prepro>} cgtagGGATCCgggcttttgtcacaggggtaaac
pBca1256-K112610
Construction of {PhoA>} basic part K112610 PCR cb10007/sc013 on MG1655 (94 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112610 ------------------------------------------------------ cb10007 Fwd biobricking of {prepro>} cgataGAATTCatgAGATCTatgaaacaaagcactattgcactggc sc013 Reverse biobricking of {prepro>} ccagtGGATCCggcttttgtcacaggggtaaac
pBca1256-K112611
Construction of {LamB>} basic part K112611 PCR cb10009/sc014 on MG1655 (107 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112605 ------------------------------------------------------ cb10009 Fwd biobricking of {prepro>} cgataGAATTCatgAGATCTatgatgattactctgcgcaaac sc014 Reverse biobricking of {prepro>} ccagtGGATCCagccattgcctgagcagac
pBca1256-K112612
Construction of {a~PhoA>} basic part K112612 PCR sc012/sc013 on MG1655 (98 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112605 ------------------------------------------------------ sc012 Fwd biobricking of {a~prepro>} cgataGAATTCatgAGATCTtaaaAtgaaacaaagcactattgcactggc sc013 Reverse biobricking of {prepro>} ccagtGGATCCggcttttgtcacaggggtaaac
pBca1256-K112613
Construction of {a~LamB>} basic part K112613 PCR sc009/sc014 on MG1655 (111 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112605 ------------------------------------------------------ sc009 Fwd biobricking of {a~prepro>} cgataGAATTCatgAGATCTtagaatgatgattactctgcgc sc014 Reverse biobricking of {prepro>} ccagtGGATCCagccattgcctgagcagac
pBca1256-K112614
Construction of {rbs_PhoA>} basic part K112614 PCR sc010/sc013 on MG1655 (112 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112605 ------------------------------------------------------ sc010 Fwd biobricking of {rbs_prepro>} cgataGAATTCatgAGATCTgtacatggagaaaataaaAtgaaacaaagcac sc013 Reverse biobricking of {prepro>} ccagtGGATCCggcttttgtcacaggggtaaac
pBca1256-K112615
Construction of {rbs_LamB>} basic part K112615 PCR sc011/sc014 on MG1655 (126 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112605 ------------------------------------------------------ sc011 Fwd biobricking of {rbs_prepro>} cgataGAATTCatgAGATCTcaatgactcaggagatagaatg sc014 Reverse biobricking of {prepro>} ccagtGGATCCagccattgcctgagcagac
pBca1102-Bca9194 Assembly part
PCR ca998/mea037 on Bca9194 (1610 bp, EcoRI/BamHI?) Sub into {<tag!}.{b1006} composite part (CK vector) (EcoRI/BamHI,____+__) Product is _______________ --------------------------------------------------------- ca998 Fwd biobricking gtatcacgaggcagaatttcag mea037 Reverse biobricking of {<phoA>} cgttaGGATCCCTTCAGGCCCAGCGCCGCTTTCATG