"
Template:Team:UC Berkeley/Notebook/DV construction
From 2008.igem.org
(Difference between revisions)
Dirkvandepol (Talk | contribs) |
Dirkvandepol (Talk | contribs) |
||
| Line 117: | Line 117: | ||
----------------------------------------------- | ----------------------------------------------- | ||
dv019 Forward biobricking of <PfhuA> | dv019 Forward biobricking of <PfhuA> | ||
| - | + | cgataGAATTCatgAGATCTgctaagcgtgaaataccggatgg | |
| + | |||
dv020 Reverse biobricking of <PfhuA> | dv020 Reverse biobricking of <PfhuA> | ||
| - | + | cgttaGGATCCactctgatgtaaagtgaatgataacg | |
| + | |||
</pre> | </pre> | ||
| Line 132: | Line 134: | ||
----------------------------------------------- | ----------------------------------------------- | ||
dv021 Forward biobricking of b1006 | dv021 Forward biobricking of b1006 | ||
| - | + | cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg | |
| + | |||
dv022 Reverse biobricking of b1006 | dv022 Reverse biobricking of b1006 | ||
GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt | GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt | ||
| Line 146: | Line 149: | ||
----------------------------------------------- | ----------------------------------------------- | ||
dv023 Forward biobricking of Bca1041 | dv023 Forward biobricking of Bca1041 | ||
| - | + | cgataGAATTCatgAGATCTgCcggcttatcGgtcagtttc | |
| + | |||
| + | |||
dv024 Reverse biobricking of Bca1041 | dv024 Reverse biobricking of Bca1041 | ||
| - | + | cgttaGGATCCatttcttttgggtatagcgtcgtgg | |
| + | |||
</pre> | </pre> | ||
Revision as of 06:28, 12 June 2008
Contents |
K112701
Construction of [<Phns>] Basic Part K112701 PCR dv001/dv006 on Phns from E. coli K12 MG1655 (150 bp, gp = A) PCR dv005/dv003 on Phns from E. coli K12 MG1655 (225 bp, gp = B) PCR dv004/dv002 on Phns from E. coli K12 MG1655 (342 bp, gp = C) --------------------------------------------------- PCR dv001/dv003 on A+B (355 bp, gp = D) --------------------------------------------------- PCR dv001/dv002 on C+D (697bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+697) Product is pBca1256-K112701 ----------------------------------------------- dv001 Forward Biobricking of [<Phns>] CgATAgaattcATGagatctGAAATATAGCTGTGCCATCAGCC dv002 Reverse Biobricking of [<Phns>] cagtcggatccGCACGAAGAGTACGGATG dv003 Removing the 2nd EcoRI site in [<Phns>] (R) GCCAGGAATGTAAGGAATTCAAAATTGTTC dv004 Removing the 2ND EcoRI site in [<Phns>] (F) GAACAATTTTGAATcCCTTACATTCCTGGC dv005 Removing the FIRST EcoRI site in [<Phns>] (F)CGCTTAATAGGGgATTCTCGTAAACAC dv006 Removing the FIRST EcoRI site in [<Phns>] (R)GTGTTTACGAGAATcCCCTATTAAGCG
K112702
Construction of <His-Tag! Basic Part K112702 Mixing of dv007/dv008 (27bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+27, L) Product is pBca1256-K112702 ----------------------------------------------- dv007 Forward biobricking of <His-Tag! CATCATCATCATCATCATtaaGGATCC dv008 Reverse biobriquing of <His-Tag! GGATCCttaATGATGATGATGATGATG
K112703
Construction of His-Tag> basic part K112703 Mix dv009/dv010 (41bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+41, L) Product is pBca1256-K112703 ----------------------------------------------- dv009 Forward Biobricking of His-Tag> cgataGAATTCatgAGATCTatgCATCATCATCATCATCATGGATCCtaacg dv010 Reverse Biobricking of His-Tag> cgttaGGATCCATGATGATGATGATGATGcatAGATCTcatGAATTCtatgg
K112704
Construction of <S-tag! basic part K112704 Wobble PCR of dv011/dv012 (60 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI) Product is pBca1256-K112704 ---------------------------------------- dv011 Forward Biobricking of <S-Tag! cgataGAATTCatgAGATCTaaagaaaccgctgctgctaaattcgaacgcc dv012 Reverse Biobricking of <S-Tag! cgttaGGATCCttagctgtccatgtgctggcgttcgaatttagcagc
K112705
Construction of S-tag> basic part K112705 Mix dv013/dv014 on pBca1 (47 bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+47, L) Product is pBca1256-K112705 ----------------------------------------------- dv013 Forward Biobricking of S-Tag> cgataGAATTCatgAGATCTatgaaagaaaccgctgctgctaaattcg dv014 Reverse Biobricking of S-Tag> cgttaGGATCCgctgtccatgtgctggcgttcgaatttagcagcagcgg
K112706
Construction of <Pspv2> basic part K112706 PCR of dv015/dv016 on pBca1037 (500bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+ 500, L) Product is pBca1256-K112706 ----------------------------------------------- dv015 Forward biobricking of <Pspv2> cgataGAATTCatgAGATCTccttatgcagcgtaagggccgcaac dv016 Reverse biobricking of <Pspv2> cgttaGGATCCGATAATGTtTGCAGGGGAATTATTTTG
K112707
Construction of <Pspv> basic part K112707 PCR of dv017/dv016 on pBca1037 (499bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+499, L) Product is pBca1256-K112707 ----------------------------------------------- dv017 Forward biobricking of <Pspv> cgataGAATTCatgAGATCTaGATCCTGTGATGTTTGGCG dv016 Reverse biobricking of <Pspv> cgttaGGATCCGATAATGTtTGCAGGGGAATTATTTTG
K112708
Construction of <PfhuA> basic part K112708 PCR of dv019/dv020 on pBjh1205 (225bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+225, L) Product is pBca1256-K112708 ----------------------------------------------- dv019 Forward biobricking of <PfhuA> cgataGAATTCatgAGATCTgctaagcgtgaaataccggatgg dv020 Reverse biobricking of <PfhuA> cgttaGGATCCactctgatgtaaagtgaatgataacg
K112709
Construction of <b1006> basic part K112709 Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+66, L) Product is pBca1256-K112709 ----------------------------------------------- dv021 Forward biobricking of b1006 cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg dv022 Reverse biobricking of b1006 GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt
K112710
Construction of <Bca1041> basic part K112710 PCR of dv023/dv024 Bca1041 (122bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+122, L) Product is pBca1256-K112710 ----------------------------------------------- dv023 Forward biobricking of Bca1041 cgataGAATTCatgAGATCTgCcggcttatcGgtcagtttc dv024 Reverse biobricking of Bca1041 cgttaGGATCCatttcttttgggtatagcgtcgtgg
