EPF-Lausanne/5 September 2008

From 2008.igem.org

(Difference between revisions)
(New page: [https://2008.igem.org/wiki/index.php?title=EPF-Lausanne/4_September_2008 <<Previous] - [https://2008.igem.org/Team:EPF-Lausanne/Notebook Back to Notebook] - [https://2008.igem.org/wiki/inde...)
 
Line 7: Line 7:
tcacgaggcagaatttcaga, pSB1A2FW
tcacgaggcagaatttcaga, pSB1A2FW
 +
aaccgtattaccgcctttga, pSB1A2RV
aaccgtattaccgcctttga, pSB1A2RV
 +
gcgaccagcagaacatctc, AB1seqFW
gcgaccagcagaacatctc, AB1seqFW
 +
ccagactctaagcggctcac, AB2seqFW
ccagactctaagcggctcac, AB2seqFW
 +
caattagcctttttatgccaaca, CD1FW
caattagcctttttatgccaaca, CD1FW
The first two primers are on the plasmid pSB1A2 and can thus be reused as primers for all parts in the same plasmid. The 3 others are specific to AB resp. CD.
The first two primers are on the plasmid pSB1A2 and can thus be reused as primers for all parts in the same plasmid. The 3 others are specific to AB resp. CD.
The primers have been ordered today.
The primers have been ordered today.

Latest revision as of 09:50, 27 October 2008

<<Previous - Back to Notebook - Next>>

Sequencing

We want to sequence AB and CD. We designed the following primers:

tcacgaggcagaatttcaga, pSB1A2FW

aaccgtattaccgcctttga, pSB1A2RV

gcgaccagcagaacatctc, AB1seqFW

ccagactctaagcggctcac, AB2seqFW

caattagcctttttatgccaaca, CD1FW

The first two primers are on the plasmid pSB1A2 and can thus be reused as primers for all parts in the same plasmid. The 3 others are specific to AB resp. CD. The primers have been ordered today.