Template:Team:UC Berkeley/Notebook/CC construction
From 2008.igem.org
(Difference between revisions)
Cicikashou (Talk | contribs) |
Cicikashou (Talk | contribs) |
||
Line 29: | Line 29: | ||
cc002 Reverse biobricking of {<HA!} | cc002 Reverse biobricking of {<HA!} | ||
ccagtggatccttaccagcgtagtctgggacgtcgtatgggtaag | ccagtggatccttaccagcgtagtctgggacgtcgtatgggtaag | ||
+ | </pre> | ||
+ | |||
+ | ==K112503== | ||
+ | <pre> | ||
+ | Construction of {<myc>} basic part K112503 | ||
+ | |||
+ | Wobble PCR of cc004/cc005 (___bp, EcoRI/BamHI) | ||
+ | Sub into pBca1256 (EcoRI/BamHI) | ||
+ | Product is pBca1256-K112503 | ||
+ | -------------------------------------------- | ||
+ | cc004 Forward Biobricking of {<myc>} | ||
+ | CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG | ||
+ | cc005 Reverse Biobricking of {<myc>} | ||
+ | ccagtggatccCAGATCCTCTTCTGAGATGAGTTTTTG | ||
</pre> | </pre> |
Revision as of 15:34, 24 June 2008
Contents |
K112501
Construction of {<HA>} basic part K112501 Wobble PCR of cc001/cc002 (___bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI) Product is pBca1256-K112501 -------------------------------------------- cc001 Forward Biobricking of {<HA>} CgATAgaattcATGagatcttacccatacgacgtcccagac cc002 Reverse biobricking of {<HA>} ccagtggatccccagcgtagtctgggacgtcgtatggg
K112502
Construction of {<HA!} basic part K112502 Wobble PCR of cc001/cc003 (___bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI) Product is pBca1256-K112502 -------------------------------------------- cc001 Forward Biobricking of {<HA>} CgATAgaattcATGagatcttacccatacgacgtcccagac cc002 Reverse biobricking of {<HA!} ccagtggatccttaccagcgtagtctgggacgtcgtatgggtaag
K112503
Construction of {<myc>} basic part K112503 Wobble PCR of cc004/cc005 (___bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI) Product is pBca1256-K112503 -------------------------------------------- cc004 Forward Biobricking of {<myc>} CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG cc005 Reverse Biobricking of {<myc>} ccagtggatccCAGATCCTCTTCTGAGATGAGTTTTTG