"
Template:Team:UC Berkeley/Notebook/CC construction
From 2008.igem.org
(Difference between revisions)
Cicikashou (Talk | contribs) (→K112505) |
Cicikashou (Talk | contribs) |
||
| (11 intermediate revisions not shown) | |||
| Line 3: | Line 3: | ||
==K112500== | ==K112500== | ||
<pre> | <pre> | ||
| - | Construction of {<HA>} basic part | + | Construction of {<HA>} basic part K112500 |
Wobble PCR of cc001/cc002 ( 50 bp, EcoRI/BamHI) | Wobble PCR of cc001/cc002 ( 50 bp, EcoRI/BamHI) | ||
| Line 18: | Line 18: | ||
==K112501== | ==K112501== | ||
<pre> | <pre> | ||
| - | Construction of {<HA!} basic part | + | Construction of {<HA!} basic part K112501 |
Wobble PCR of cc001/cc003 ( 53 bp, EcoRI/BamHI) | Wobble PCR of cc001/cc003 ( 53 bp, EcoRI/BamHI) | ||
| Line 33: | Line 33: | ||
==K112502== | ==K112502== | ||
<pre> | <pre> | ||
| - | Construction of {<myc>} basic part | + | Construction of {<myc>} basic part K112502 |
Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI) | Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI) | ||
| Line 63: | Line 63: | ||
Construction of {<barnase>} basic part K112504 | Construction of {<barnase>} basic part K112504 | ||
| - | PCR CC007/CC008 on barnase gene ( | + | PCR CC007/CC008 on barnase gene ( 361 bp, EcoRI/BamHI) |
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | ||
Product is pBca1256-K112504 | Product is pBca1256-K112504 | ||
| Line 70: | Line 70: | ||
CGATAgaattcATGaGATCTGCACAGG | CGATAgaattcATGaGATCTGCACAGG | ||
CC008 Reverse Biobricking of {<barnase>} | CC008 Reverse Biobricking of {<barnase>} | ||
| - | + | CCAGTggatccTCTGATTTTTGTAAAGGTCTG | |
</pre> | </pre> | ||
| Line 87: | Line 87: | ||
</pre> | </pre> | ||
| - | == | + | ==K112232 (Molly's)== |
<pre> | <pre> | ||
| - | Construction of { | + | Construction of {rbs.barstar!} Biobrick Part K112232 |
| - | + | PCR mea035/mea034 on Bacillus amyloliquefaciens gen (320 bp, EcoRI/BamHI) | |
| - | PCR mea035/mea034 on Bacillus amyloliquefaciens gen | + | Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) |
| - | Sub into pBca1256 | + | Product is pBca1256-K112232 |
| - | Product is pBca1256- | + | |
---------------------------------------- | ---------------------------------------- | ||
| - | mea035 | + | mea035 Forward Biobricking of {rbs.barstar!} |
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg | cgataGAATTCatgAGATCTcataagaaaggagccgcacatg | ||
| - | mea034 | + | mea034 Reverse Biobricking of {rbs.barstar!} |
| - | + | cgttaGGATCCttaagaaagtatgatggtgatgtcgcagcc | |
</pre> | </pre> | ||
| + | |||
| + | |||
| + | == K112233 (Molly's) == | ||
| + | <pre> | ||
| + | Construction of {<phoA>} Biobrick Part K112233 | ||
| + | PCR mea036/mea037 on pBca9145-Bca1126 (1219 bp, EcoRI/BamHI) | ||
| + | Sub into pBjh1601AC-Bca1144 (EcoRI/BamHI, 3195,910 L) | ||
| + | Product is pBjh1601AC-K112233 | ||
| + | ---------------------------------------- | ||
| + | mea036 Forward Biobricking of {<phoA>} cgatagaattcatgAGATCTGGAGATTCTG | ||
| + | mea037 Reverse Biobricking of {<phoA>} cgttaGGATCCCTTCAGGCCCAGCGCCGCTTTCATG | ||
| + | </pre> | ||
| + | |||
| + | |||
| + | == K112506 == | ||
| + | |||
| + | <pre> | ||
| + | Construction of {<HA>} basic part K112506 | ||
| + | |||
| + | Wobble PCR of cc001/cc010 ( 51 bp, EcoRI/BamHI) | ||
| + | Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | ||
| + | Product is pBca1256-K112506 | ||
| + | -------------------------------------------- | ||
| + | cc001 Forward Biobricking of {<HA>} | ||
| + | CgATAgaattcATGagatcttacccatacgacgtcccagac | ||
| + | |||
| + | cc010 Reverse biobricking of {<HA>} | ||
| + | ccagtggatcccccagcgtagtctgggacgtcgtatggg | ||
| + | </pre> | ||
| + | |||
| + | |||
| + | == K112507 == | ||
| + | |||
| + | <pre> | ||
| + | Construction of {<HA!} basic part K112507 | ||
| + | |||
| + | Wobble PCR of cc001/cc011 ( 54 bp, EcoRI/BamHI) | ||
| + | Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | ||
| + | Product is pBca1256-K112507 | ||
| + | -------------------------------------------- | ||
| + | cc001 Forward Biobricking of {<HA>} | ||
| + | CgATAgaattcATGagatcttacccatacgacgtcccagac | ||
| + | |||
| + | cc011 Reverse biobricking of {<HA!} | ||
| + | ccagtggatccttacccagcgtagtctgggacgtcgtatgggtaag | ||
| + | |||
| + | </pre> | ||
| + | |||
| + | |||
| + | -------------------------------------------------------------------------------------------------------------- | ||
| + | |||
| + | <div style="text-align: center;"> [[Team:UC_Berkeley/Notebook/Cici_Chen|Cici Chen]] </div> | ||
| + | <div style="text-align: center;"> [[Team:UC_Berkeley/Notebook| All notebook]] </div> | ||
Latest revision as of 01:58, 25 July 2008
Contents |
K112500
Construction of {<HA>} basic part K112500
Wobble PCR of cc001/cc002 ( 50 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)
Product is pBca1256-K112500
--------------------------------------------
cc001 Forward Biobricking of {<HA>}
CgATAgaattcATGagatcttacccatacgacgtcccagac
cc002 Reverse biobricking of {<HA>}
ccagtggatccccagcgtagtctgggacgtcgtatggg
K112501
Construction of {<HA!} basic part K112501
Wobble PCR of cc001/cc003 ( 53 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)
Product is pBca1256-K112501
--------------------------------------------
cc001 Forward Biobricking of {<HA>}
CgATAgaattcATGagatcttacccatacgacgtcccagac
cc003 Reverse biobricking of {<HA!}
ccagtggatccttaccagcgtagtctgggacgtcgtatgggtaag
K112502
Construction of {<myc>} basic part K112502
Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)
Product is pBca1256-K112502
--------------------------------------------
cc004 Forward Biobricking of {<myc>}
CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG
cc005 Reverse Biobricking of {<myc>}
ccagtggatccCAGATCCTCTTCTGAGATGAGTTTTTG
K112503
Construction of {<myc!} basic part K112503
Wobble PCR of cc004/cc006 ( 54 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI,2227+ 910,L)
Product is pBca1256-K112503
--------------------------------------------
cc004 Forward Biobricking of {<myc>}
CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG
cc006 Reverse Biobricking of {<myc!}
ccagtggatccTTACAGATCCTCTTCTGAGATGAGTTTTTGTTC
K112504
Construction of {<barnase>} basic part K112504
PCR CC007/CC008 on barnase gene ( 361 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)
Product is pBca1256-K112504
--------------------------------------------
cc007 Forward Biobricking of {<barnase>}
CGATAgaattcATGaGATCTGCACAGG
CC008 Reverse Biobricking of {<barnase>}
CCAGTggatccTCTGATTTTTGTAAAGGTCTG
K112505
Construction of {<barnase!} basic part K112505
PCR CC007/CC009 on barnase gene ( 364 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)
Product is pBca1256-K112505
--------------------------------------------
cc007 Forward Biobricking of {<barnase!}
CGATAgaattcATGaGATCTGCACAGG
CC009 Reverse Biobricking of {<barnase!}
CCAGTggatcCTTATCTGATTTTTG
K112232 (Molly's)
Construction of {rbs.barstar!} Biobrick Part K112232
PCR mea035/mea034 on Bacillus amyloliquefaciens gen (320 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2472+910, L)
Product is pBca1256-K112232
----------------------------------------
mea035 Forward Biobricking of {rbs.barstar!}
cgataGAATTCatgAGATCTcataagaaaggagccgcacatg
mea034 Reverse Biobricking of {rbs.barstar!}
cgttaGGATCCttaagaaagtatgatggtgatgtcgcagcc
K112233 (Molly's)
Construction of {<phoA>} Biobrick Part K112233
PCR mea036/mea037 on pBca9145-Bca1126 (1219 bp, EcoRI/BamHI)
Sub into pBjh1601AC-Bca1144 (EcoRI/BamHI, 3195,910 L)
Product is pBjh1601AC-K112233
----------------------------------------
mea036 Forward Biobricking of {<phoA>} cgatagaattcatgAGATCTGGAGATTCTG
mea037 Reverse Biobricking of {<phoA>} cgttaGGATCCCTTCAGGCCCAGCGCCGCTTTCATG
K112506
Construction of {<HA>} basic part K112506
Wobble PCR of cc001/cc010 ( 51 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)
Product is pBca1256-K112506
--------------------------------------------
cc001 Forward Biobricking of {<HA>}
CgATAgaattcATGagatcttacccatacgacgtcccagac
cc010 Reverse biobricking of {<HA>}
ccagtggatcccccagcgtagtctgggacgtcgtatggg
K112507
Construction of {<HA!} basic part K112507
Wobble PCR of cc001/cc011 ( 54 bp, EcoRI/BamHI)
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L)
Product is pBca1256-K112507
--------------------------------------------
cc001 Forward Biobricking of {<HA>}
CgATAgaattcATGagatcttacccatacgacgtcccagac
cc011 Reverse biobricking of {<HA!}
ccagtggatccttacccagcgtagtctgggacgtcgtatgggtaag
