Team:Hawaii/Biobrick conversions

From 2008.igem.org

(Difference between revisions)
(Extraction of Biobrick MCS)
(Sequencing)
 
(48 intermediate revisions not shown)
Line 5: Line 5:
===PCR mutagenesis of GFP===
===PCR mutagenesis of GFP===
* Combined:
* Combined:
-
:* 1 μl colony sample (above)
+
:* 0.5 μl BBa_E0040 plasmid
:* 0.5 μl 10mM forward primer
:* 0.5 μl 10mM forward primer
:* 0.5 μl 10mM reverse primer
:* 0.5 μl 10mM reverse primer
-
:* 3 μl nanopure water
+
:* 3.5 μl nanopure water
:* 5 μl ''Taq'' (we used EconoTaq Green Taq)
:* 5 μl ''Taq'' (we used EconoTaq Green Taq)
* Ran for 30 cycles of denaturing, annealing, extension
* Ran for 30 cycles of denaturing, annealing, extension
Line 45: Line 45:
===Extraction of Biobrick MCS===
===Extraction of Biobrick MCS===
* Combined:
* Combined:
-
:* 0.5 μl BBa_C0012 plasmid
+
:* 0.5 μl BBa_B0034 plasmid
:* 0.5 μl 10mM forward primer
:* 0.5 μl 10mM forward primer
:* 0.5 μl 10mM reverse primer
:* 0.5 μl 10mM reverse primer
Line 57: Line 57:
:* Final extension @ 72C for 10 min.
:* Final extension @ 72C for 10 min.
:* Held @ 4C inifinitly.
:* Held @ 4C inifinitly.
-
<div style="text-align: center;"> '''Extraction of Biobricks verification, txn termination, and RE sites from any BioBrick vectors containing VF2 and VR'''<div>
+
<div style="text-align: center;"> '''Extraction of Biobricks verification, txn termination, and RE sites from any BioBrick vectors containing VF2 and VR'''</div>
{| border="1" class="wikitable"
{| border="1" class="wikitable"
! Primer
! Primer
Line 82: Line 82:
===Subcloning of GFP fusion brick and pRL1383a Biobrick vector===
===Subcloning of GFP fusion brick and pRL1383a Biobrick vector===
 +
====Restriction digest====
 +
* GFP fusion
 +
* BBa_C0012
 +
* BBa_B0034 derived MCS
 +
* pRL1383a
 +
 +
====Ligated insert and vector====
 +
* Ran 20 &mu;l ligation reactions
 +
:* 7 &mu;l BioBrick segment (~2.8 ng) + 0.5 &mu;l pRL1383a vector (~0.95 ng)
 +
:* 7 &mu;l GFP fusion (~7 ng) + 2 &mu;l C0012 derived vector (~1.8 ng)
 +
 +
====Transformed into DH5&alpha;====
 +
* Used 10 &mu;l of ligation reaction to transform.
 +
* Incubated 10 min. on ice after addition of DNA.
 +
* Plated GFP fusion + vector on LB + amp<sub>100</sub>
 +
* Plated MCS + pRL1383a on LB + sp<sub>100</sub>
 +
===Verification of parts===
 +
====[[Team:Hawaii/Protocols/Colony_PCR|Colony PCR]]====
 +
 +
====Sequencing====
 +
* 5 &mu;l of the PCR products were digested with 2 &mu;l ExoSAP.
 +
* Samples were sent to CORE Hawaii for sequencing.
 +
:* 12 &mu;l sample with 3.2 pmol primer and 20ng/100bp concentration of PCR product
 +
 +
===Reconstruction of BB-pRL1383a===
 +
====PCR extraction of ccdB gene and BioBrick MCS====
 +
* Combined:
 +
:* 1.0 &mu;l pSB1A3 plasmid
 +
:* 0.5 &mu;l 10mM forward primer
 +
:* 0.5 &mu;l 10mM reverse primer
 +
:* 3 &mu;l nanopure water
 +
:* 5 &mu;l ''Taq'' (we used EconoTaq Green Taq)
 +
* Ran for 30 cycles of denaturing, annealing, extension
 +
:* Initial denature @ 94C for 2 min.
 +
:* Denature @ 94C for 30 sec.
 +
:* Anneal @ 54, 58, 62C for 30 sec.
 +
:* Extend @ 72C for 90 sec.
 +
:* Final extension @ 72C for 10 min.
 +
:* Held @ 4C inifinitly.
 +
 +
(Note: same primers as before)
 +
 +
===Subcloning of ccdB and BioBrick MCS in BB-pRL1383a===
 +
====PCR extraction of lac device and BioBrick MCS====
 +
* Combined:
 +
:* 1.0 &mu;l BBa_J33207
 +
:* 0.5 &mu;l 10mM forward primer
 +
:* 0.5 &mu;l 10mM reverse primer
 +
:* 3 &mu;l nanopure water
 +
:* 5 &mu;l ''Taq'' (we used EconoTaq Green Taq)
 +
* Ran for 30 cycles of denaturing, annealing, extension
 +
:* Initial denature @ 94C for 2 min.
 +
:* Denature @ 94C for 30 sec.
 +
:* Anneal @ 54, 58, 62C for 30 sec.
 +
:* Extend @ 72C for 90 sec.
 +
:* Final extension @ 72C for 10 min.
 +
:* Held @ 4C inifinitly.
 +
 +
(Note: same primers as before)
 +
 +
====Restriction digest====
 +
:* Sequential digest of pRL1383a and ccdB with HindIII then BamHI in NEBuffer 2 + BSA
 +
 +
===Subcloning of lac device and BioBrick MCS in BB-pRL1383a===
 +
 +
====Restriction digest====
 +
:* Sequential digest of pRL1383a and J33207/MCS segment with BamHI then HindIII
 +
::* 10 &mu;l pRL1383a plasmid prep digested with Roche enzymes in Roche buffer M
 +
::* 5 &mu;l J33207 PCR product digested with Roche enzymes in Roche buffer M
 +
:* Gel purified
 +
 +
====Ligation====
 +
:* Ligated 1 &mu;l pRL1383a (44.4 ng) w/ 4 &mu;l J33207 (118.4 ng) with Quick T4 DNA ligase
 +
 +
====Transformed into DB3.1 cells====
 +
:* Used 5 &mu;l ligation reaction to transform
 +
 +
====Colony PCR to verify transformants====
 +
 +
====Sequencing====
 +
====Restriction digest====
 +
:* Modified pRL1383a (5080 ng) digested sequentially with EcoRI (1.5 hours) and PstI (2 hours)
 +
:* J33207 PCR product digested with EcoRI and PstI (2 hours)
 +
====Ligation====
 +
====Transformation into DH5 &alpha;====
 +
==Results==
==Results==
 +
[[Image:071808pcrgel.jpg|thumb|right|200 px|Colony PCR. Ten microliters of colony PCR reactions were loaded into each well of an EtBr stained 4% agarose gel ran at 95V for 50 min.]]
 +
===Attempt #1===
 +
==== Transformation into DH5&alpha;====
 +
Sixty colonies were observed for GFP fusion and there were too many colonies to count (>300) for the modified pRL1383a.
 +
====Verification of transformants====
 +
A colony PCR was conducted to verify the presence of the GFP fusion brick containing plasmid and the modified pRL1383a. PCR products observed on the gel were of the expected size. One band was observed for pRL1383a (MCS=~50bp + ~250bp(upstream/downstream verification regions)) and the GFP fusion brick (720bp + ~250bp(upstream/downstream verification regions).
 +
 +
====Sequencing====
 +
Sequencing by the Greenwood Molecular Biology Facility returned the following sequences:
 +
 +
=====GFP fusion=====
 +
[[Image:gfpfusionsequence.jpeg|970px]]
 +
 +
=====pRL1383a multiple cloning site=====
 +
Sequencing returned results that did not match the expected VF-VR from B0034. When Blasted against the parts registry as well as the NCBI database, no significant results were found. Currently, we have no idea what the sequence is. The read was dirty so perhaps the results were just that of a bad read sample?
 +
===Attempt #2===
 +
====Restriction digests====
 +
[[Image:073008REdigests.jpg|thumb|right|200px|EtBr stained 1.2% agarose gel ran at 59V for 90 min. Twenty microliters of the restriction digest reactions were loaded into each well.]]
 +
Smear between 8-10kb may be due to too much pRL1383a plasmid? Two bands were observed for the RE digest of the J33207 PCR product. One band, ~1kb, is the size of the expected DNA fragment. The larger band, ~9kb, is yet unidentified.
 +
====Transformation into DB3.1====
 +
Five colonies were observed for the modified pRL1383a.
 +
====Sequencing====
 +
Sequencing by the Greenwood Molecular Biology Facility returned the following sequence:
 +
=====pRL1383a=====
 +
[[Image:pRL1383agfpsequence.jpg|970px]]
 +
 +
[http://partsregistry.org/Part:BBa_E0040 GFP] was inserted into pRL1383a instead of the [http://partsregistry.org/Part:BBa_J33207 lac device] for blue/white screening. Plasmid prep from which J33207 was extracted was mislabeled. Explains why [https://2008.igem.org/Image:080808seqPCR.jpg colony PCR] band was closer to 900bp than 800bp (GFP is 100bp larger than the lac device).
 +
==Discussion==
==Discussion==
 +
Success! GFP fusion has been added to BioBrick registry and will be submitted at a later date. Need to redo pRL1383a assembly.
 +
 +
ccdB has a BamHI site within the gene. Oops! Switch to J33207 (lac promoter + rbs + lacZ) for screening of successfully ligated plasmid in transformants.
 +
 +
The pRL1383a MCS was successfully replaced with a BioBrick MCS and part. However, due to a mislabeling error, J33207 was not inserted into pRL1383a. A digestion of the modified pRL1383a with EcoRI and PstI will be carried out to introduce J33207 into the plasmid for blue/white screening of transformants.

Latest revision as of 20:53, 15 August 2008

Contents

Objectives

  • Convert GFP (BBa_E0040) into a fusion brick using site-directed mutagenesis.
  • Convert pRL1383a into a Biobrick vector by replacing its natural MCS with the Biobrick MCS

Protocol

PCR mutagenesis of GFP

  • Combined:
  • 0.5 μl BBa_E0040 plasmid
  • 0.5 μl 10mM forward primer
  • 0.5 μl 10mM reverse primer
  • 3.5 μl nanopure water
  • 5 μl Taq (we used EconoTaq Green Taq)
  • Ran for 30 cycles of denaturing, annealing, extension
  • Initial denature @ 94C for 2 min.
  • Denature @ 94C for 30 sec.
  • Anneal @ 55C for 30 sec.
  • Extend @ 72C for 60 sec.
  • Final extension @ 72C for 10 min.
  • Held @ 4C inifinitly.
GFP fusion brick (site directed mutagenesis)
Primer Sequence Length G/C content Tm Notes
GFP fusion foward GCCGCTTCTAGAcgtaaaggag 22 bp 54.55% 60.2 C PCR out from E0040, starts annealing from partial NotI (5 of 8 nucleotides of) site, continues with XbaI, omits TG of ATG codon for site directed mutagenesis, begins again with GFP codon 2-4 (cgt aaa gga)
GFP fusion reverse cgagtcagtgagcgaggaag 20 bp 60% 59.6 C PCR out from E0040, priming after all end sites (5'taataa t actagt a gcggccg ctgcag gCTTCCTCGCTCACTGACTCG3')

Extraction of Biobrick MCS

  • Combined:
  • 0.5 μl BBa_B0034 plasmid
  • 0.5 μl 10mM forward primer
  • 0.5 μl 10mM reverse primer
  • 3.5 μl nanopure water
  • 5 μl Taq (we used EconoTaq Green Taq)
  • Ran for 30 cycles of denaturing, annealing, extension
  • Initial denature @ 94C for 2 min.
  • Denature @ 94C for 30 sec.
  • Anneal @ 55C for 30 sec.
  • Extend @ 72C for 90 sec.
  • Final extension @ 72C for 10 min.
  • Held @ 4C inifinitly.
Extraction of Biobricks verification, txn termination, and RE sites from any BioBrick vectors containing VF2 and VR
Primer Sequence Length G/C content Tm Notes
HindIII+VF2 cctAAGCTTtgccacctgacgtctaagaa 29 bp (20 bp) 48.3% (50.0%) 65.9 C (58.6 C) Includes RE extension HindIII site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VF2 primer.
BamHI+VR ccaGGATCCattaccgcctttgagtgagc 29 bp (20 bp) 55.2% (50.0%) 67.9 C (58.0 C) Includes RE extension BamHI site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VR primer.

Subcloning of GFP fusion brick and pRL1383a Biobrick vector

Restriction digest

  • GFP fusion
  • BBa_C0012
  • BBa_B0034 derived MCS
  • pRL1383a

Ligated insert and vector

  • Ran 20 μl ligation reactions
  • 7 μl BioBrick segment (~2.8 ng) + 0.5 μl pRL1383a vector (~0.95 ng)
  • 7 μl GFP fusion (~7 ng) + 2 μl C0012 derived vector (~1.8 ng)

Transformed into DH5α

  • Used 10 μl of ligation reaction to transform.
  • Incubated 10 min. on ice after addition of DNA.
  • Plated GFP fusion + vector on LB + amp100
  • Plated MCS + pRL1383a on LB + sp100

Verification of parts

Colony PCR

Sequencing

  • 5 μl of the PCR products were digested with 2 μl ExoSAP.
  • Samples were sent to CORE Hawaii for sequencing.
  • 12 μl sample with 3.2 pmol primer and 20ng/100bp concentration of PCR product

Reconstruction of BB-pRL1383a

PCR extraction of ccdB gene and BioBrick MCS

  • Combined:
  • 1.0 μl pSB1A3 plasmid
  • 0.5 μl 10mM forward primer
  • 0.5 μl 10mM reverse primer
  • 3 μl nanopure water
  • 5 μl Taq (we used EconoTaq Green Taq)
  • Ran for 30 cycles of denaturing, annealing, extension
  • Initial denature @ 94C for 2 min.
  • Denature @ 94C for 30 sec.
  • Anneal @ 54, 58, 62C for 30 sec.
  • Extend @ 72C for 90 sec.
  • Final extension @ 72C for 10 min.
  • Held @ 4C inifinitly.

(Note: same primers as before)

Subcloning of ccdB and BioBrick MCS in BB-pRL1383a

PCR extraction of lac device and BioBrick MCS

  • Combined:
  • 1.0 μl BBa_J33207
  • 0.5 μl 10mM forward primer
  • 0.5 μl 10mM reverse primer
  • 3 μl nanopure water
  • 5 μl Taq (we used EconoTaq Green Taq)
  • Ran for 30 cycles of denaturing, annealing, extension
  • Initial denature @ 94C for 2 min.
  • Denature @ 94C for 30 sec.
  • Anneal @ 54, 58, 62C for 30 sec.
  • Extend @ 72C for 90 sec.
  • Final extension @ 72C for 10 min.
  • Held @ 4C inifinitly.

(Note: same primers as before)

Restriction digest

  • Sequential digest of pRL1383a and ccdB with HindIII then BamHI in NEBuffer 2 + BSA

Subcloning of lac device and BioBrick MCS in BB-pRL1383a

Restriction digest

  • Sequential digest of pRL1383a and J33207/MCS segment with BamHI then HindIII
  • 10 μl pRL1383a plasmid prep digested with Roche enzymes in Roche buffer M
  • 5 μl J33207 PCR product digested with Roche enzymes in Roche buffer M
  • Gel purified

Ligation

  • Ligated 1 μl pRL1383a (44.4 ng) w/ 4 μl J33207 (118.4 ng) with Quick T4 DNA ligase

Transformed into DB3.1 cells

  • Used 5 μl ligation reaction to transform

Colony PCR to verify transformants

Sequencing

Restriction digest

  • Modified pRL1383a (5080 ng) digested sequentially with EcoRI (1.5 hours) and PstI (2 hours)
  • J33207 PCR product digested with EcoRI and PstI (2 hours)

Ligation

Transformation into DH5 α

Results

Colony PCR. Ten microliters of colony PCR reactions were loaded into each well of an EtBr stained 4% agarose gel ran at 95V for 50 min.

Attempt #1

Transformation into DH5α

Sixty colonies were observed for GFP fusion and there were too many colonies to count (>300) for the modified pRL1383a.

Verification of transformants

A colony PCR was conducted to verify the presence of the GFP fusion brick containing plasmid and the modified pRL1383a. PCR products observed on the gel were of the expected size. One band was observed for pRL1383a (MCS=~50bp + ~250bp(upstream/downstream verification regions)) and the GFP fusion brick (720bp + ~250bp(upstream/downstream verification regions).

Sequencing

Sequencing by the Greenwood Molecular Biology Facility returned the following sequences:

GFP fusion

Gfpfusionsequence.jpeg

pRL1383a multiple cloning site

Sequencing returned results that did not match the expected VF-VR from B0034. When Blasted against the parts registry as well as the NCBI database, no significant results were found. Currently, we have no idea what the sequence is. The read was dirty so perhaps the results were just that of a bad read sample?

Attempt #2

Restriction digests

EtBr stained 1.2% agarose gel ran at 59V for 90 min. Twenty microliters of the restriction digest reactions were loaded into each well.

Smear between 8-10kb may be due to too much pRL1383a plasmid? Two bands were observed for the RE digest of the J33207 PCR product. One band, ~1kb, is the size of the expected DNA fragment. The larger band, ~9kb, is yet unidentified.

Transformation into DB3.1

Five colonies were observed for the modified pRL1383a.

Sequencing

Sequencing by the Greenwood Molecular Biology Facility returned the following sequence:

pRL1383a

PRL1383agfpsequence.jpg

[http://partsregistry.org/Part:BBa_E0040 GFP] was inserted into pRL1383a instead of the [http://partsregistry.org/Part:BBa_J33207 lac device] for blue/white screening. Plasmid prep from which J33207 was extracted was mislabeled. Explains why colony PCR band was closer to 900bp than 800bp (GFP is 100bp larger than the lac device).

Discussion

Success! GFP fusion has been added to BioBrick registry and will be submitted at a later date. Need to redo pRL1383a assembly.

ccdB has a BamHI site within the gene. Oops! Switch to J33207 (lac promoter + rbs + lacZ) for screening of successfully ligated plasmid in transformants.

The pRL1383a MCS was successfully replaced with a BioBrick MCS and part. However, due to a mislabeling error, J33207 was not inserted into pRL1383a. A digestion of the modified pRL1383a with EcoRI and PstI will be carried out to introduce J33207 into the plasmid for blue/white screening of transformants.