User:Caleb Dulaney/How to make BioBricks

From 2008.igem.org

< User:Caleb Dulaney(Difference between revisions)
(New page: =***BioBrick Construction***= BioBricks are simply genetic "parts". They are made up of a length of DNA capped by a prefix and suffix. ***Prefix***: the prefix is DNA located before the a...)
 
(One intermediate revision not shown)
Line 1: Line 1:
-
=***BioBrick Construction***=
+
=BioBrick Construction=
BioBricks are simply genetic "parts".  They are made up of a length of DNA capped by a prefix and suffix.
BioBricks are simply genetic "parts".  They are made up of a length of DNA capped by a prefix and suffix.
-
***Prefix***: the prefix is DNA located before the actual gene you're using.   
+
*Prefix: the prefix is DNA located before the actual gene you're using.   
* If the sequence codes for protein it is:  gaattcgcggccgcttctag
* If the sequence codes for protein it is:  gaattcgcggccgcttctag
* If not, the sequence is:                  gaattcgcggccgcttctagag
* If not, the sequence is:                  gaattcgcggccgcttctagag
-
***Suffix***: the suffix is DNA located after the gene.  
+
*Suffix: the suffix is DNA located after the gene.  
* No matter what type of part you're using, the suffix is:  tactagtagcggccgctgcag
* No matter what type of part you're using, the suffix is:  tactagtagcggccgctgcag
These additions to the DNA sequence simply encode for standard restriction enzyme cutting areas and allow the parts to be easily moved around and attached to each other.
These additions to the DNA sequence simply encode for standard restriction enzyme cutting areas and allow the parts to be easily moved around and attached to each other.

Latest revision as of 14:13, 3 June 2008

BioBrick Construction

BioBricks are simply genetic "parts". They are made up of a length of DNA capped by a prefix and suffix.

  • Prefix: the prefix is DNA located before the actual gene you're using.
  • If the sequence codes for protein it is: gaattcgcggccgcttctag
  • If not, the sequence is: gaattcgcggccgcttctagag
  • Suffix: the suffix is DNA located after the gene.
  • No matter what type of part you're using, the suffix is: tactagtagcggccgctgcag

These additions to the DNA sequence simply encode for standard restriction enzyme cutting areas and allow the parts to be easily moved around and attached to each other.