User:Caleb Dulaney/How to make BioBricks
From 2008.igem.org
< User:Caleb Dulaney(Difference between revisions)
(New page: =***BioBrick Construction***= BioBricks are simply genetic "parts". They are made up of a length of DNA capped by a prefix and suffix. ***Prefix***: the prefix is DNA located before the a...) |
|||
(One intermediate revision not shown) | |||
Line 1: | Line 1: | ||
- | = | + | =BioBrick Construction= |
BioBricks are simply genetic "parts". They are made up of a length of DNA capped by a prefix and suffix. | BioBricks are simply genetic "parts". They are made up of a length of DNA capped by a prefix and suffix. | ||
- | + | *Prefix: the prefix is DNA located before the actual gene you're using. | |
* If the sequence codes for protein it is: gaattcgcggccgcttctag | * If the sequence codes for protein it is: gaattcgcggccgcttctag | ||
* If not, the sequence is: gaattcgcggccgcttctagag | * If not, the sequence is: gaattcgcggccgcttctagag | ||
- | + | *Suffix: the suffix is DNA located after the gene. | |
* No matter what type of part you're using, the suffix is: tactagtagcggccgctgcag | * No matter what type of part you're using, the suffix is: tactagtagcggccgctgcag | ||
These additions to the DNA sequence simply encode for standard restriction enzyme cutting areas and allow the parts to be easily moved around and attached to each other. | These additions to the DNA sequence simply encode for standard restriction enzyme cutting areas and allow the parts to be easily moved around and attached to each other. |
Latest revision as of 14:13, 3 June 2008
BioBrick Construction
BioBricks are simply genetic "parts". They are made up of a length of DNA capped by a prefix and suffix.
- Prefix: the prefix is DNA located before the actual gene you're using.
- If the sequence codes for protein it is: gaattcgcggccgcttctag
- If not, the sequence is: gaattcgcggccgcttctagag
- Suffix: the suffix is DNA located after the gene.
- No matter what type of part you're using, the suffix is: tactagtagcggccgctgcag
These additions to the DNA sequence simply encode for standard restriction enzyme cutting areas and allow the parts to be easily moved around and attached to each other.