Team:Warsaw/Calendar-Main/5 June 2008

From 2008.igem.org

(Difference between revisions)
 
(45 intermediate revisions not shown)
Line 1: Line 1:
{{WarNotebook}}
{{WarNotebook}}
<!-- do not edit above me! -->
<!-- do not edit above me! -->
 +
<html>
 +
<h3>Preparation of <a href=https://2008.igem.org/Wiki/Team:Warsaw/vectors/pMPM-T5-T7>pMPMT5+T7</a> construct</h3>
 +
<h4>Piotr, Weronika</h4><ol>
 +
<li> <a href="https://2008.igem.org/wiki/index.php?title=Wiki/Team:Warsaw/protocols#plasmid_DNA_isolation">Isolation</a> of hypothetical <a href=https://2008.igem.org/Wiki/Team:Warsaw/vectors/pMPM-T5-T7>pMPMT5 with T7 RNA polymerase</a>.</li>
-
<p>Transformantion of E.coli TOP10 with pZC320.<br>
+
<li>Control <a href="https://2008.igem.org/wiki/index.php?title=Wiki/Team:Warsaw/protocols#digest">digest</a> of <a href=https://2008.igem.org/Wiki/Team:Warsaw/vectors/pMPM-T5-T7>pMPMT5 + T7 RNA-polymerase </a>with EcoRI (EcoRI buffer).</li>
 +
<li> Gel electrophoresis.</li>
-
Inoculation of transformants into liquid LB broth.<br>
+
<li> Choice of proper clone and preparation for sequencing.</li>
-
Design of primers for sequencing β-galactosidase from pZC320.<br>
+
</ol>
 +
</p>  
-
Primers:<br>
+
<h3>Preparation of <a href=https://2008.igem.org/Wiki/Team:Warsaw/vectors/pMPM-T5-AID%2BAID-T7>pMPMT5-AID+AIDT7</a> construct</h3>
 +
<h4>Michał K.</h4>
 +
<p>Inoculation of colonies of transformants (pMPMT5-AID with AID-T7 RNA-polymerase translation fusion) into liquid LB+tetracycline.</p>
-
pZCseqL  CTTGACCCGCAGTTGCAAAC<br>
+
<h3> Blue/white and rifampicin test #1</h3>
 +
<h4>Michał L., Ewa, Marcin, Piotr</h4>
 +
<ol>
-
pZCseqP  CCCAACTGATCTTCAGCATC
+
<li>Inoculation of of <i>E. coli</i> <a href="https://2008.igem.org/Wiki/Team:Warsaw/igem_notebook.htm#top10">TOP10</a> with <a href="https://2008.igem.org/Wiki/Team:Warsaw/vectors/pZC320">pZC320</a> into liquid LB broth (with 30 μg/ml of ampicillin).</li>
-
</p>
+
 +
<li>Design of primers for sequencing β-galactosidase from <a href="https://2008.igem.org/Wiki/Team:Warsaw/vectors/pZC320">pZC320</a>. <br>
 +
Primers:
 +
 +
<a href="https://2008.igem.org/Wiki/Team:Warsaw/primers#pZCseqL">pZCseqL</a> and
 +
<a href="https://2008.igem.org/Wiki/Team:Warsaw/primers#pZCseqR">pZCseqR</a></li></ol>
 +
</html>

Latest revision as of 14:48, 26 October 2008

Gallery Bricks Notebook Team Project Home


Previous day
return to main notebook page
Previous entry
next notebook entry

 


Preparation of pMPMT5+T7 construct

Piotr, Weronika

  1. Isolation of hypothetical pMPMT5 with T7 RNA polymerase.
  2. Control digest of pMPMT5 + T7 RNA-polymerase with EcoRI (EcoRI buffer).
  3. Gel electrophoresis.
  4. Choice of proper clone and preparation for sequencing.

Preparation of pMPMT5-AID+AIDT7 construct

Michał K.

Inoculation of colonies of transformants (pMPMT5-AID with AID-T7 RNA-polymerase translation fusion) into liquid LB+tetracycline.

Blue/white and rifampicin test #1

Michał L., Ewa, Marcin, Piotr

  1. Inoculation of of E. coli TOP10 with pZC320 into liquid LB broth (with 30 μg/ml of ampicillin).
  2. Design of primers for sequencing β-galactosidase from pZC320.
    Primers: pZCseqL and pZCseqR