Latest revision as of 20:42, 16 July 2008

Monday 9 June

Selim Sheikh:
- Designed 2 sets of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify target regions:
  - Primer Set 1:
    - product of length 538
    - contains region of the molecule from 20481 to 21018
    - Tm = 81.7 C TaOpt: 60.4 C GC: 56.3
    - area of interest = 20833
    - sense primer: GAGACGAATGCCAGGTCATCTGAAA <---------------primer name: STF L
    - length: 25 Tm = 60.3 C GC = 48.0
    - antisense primer: AAATCTGGATCATTCCCGAGCGCTG <-----------primer name: STF R
    - length: 25 Tm = 64.9 C GC = 52.0
  - Primer Set 2:
    - product of length 309
    - contains region of the molecule from 23341 to 23649
    - Tm = 70.7 C TaOpt: 51.4 C GC: 31.7
    - area of interest = 23539
    - sense primer: ATCACATCGTCACCCATTGGATTGT <---------------primer name: ATTP L
    - length: 25 Tm = 60.1 C GC = 44.0
    - antisense primer: CGATTTAGAAATGTATAGCGAGGCA <-----------primer name: ATTP R
    - length: 25 Tm = 55.9 C GC = 40.0

Taylor Stevenson
- XL1-Blue MR cells were prepared for phage infection as specified in packaging manual [1] and infected with phage at roughly a 1/10 pfu/cfu ratio. Resulting phage/bacteria mixture was incubated @ 37*C for 20 min and then streaked onto an LB plate. Plate was incubated @ 30*C O/N.
- Result-approximately 100 possibly lysogenic colonies grew on plate.

Home	The Team	The Project	Parts Submitted to the Registry	Modeling	Notebook

@@ Line 7: / Line 7: @@
 ****Tm = 81.7 C    TaOpt: 60.4 C    GC: 56.3
 ****area of interest = 20833
-****sense primer: GAGACGAATGCCAGGTCATCTGAAA
+****sense primer: GAGACGAATGCCAGGTCATCTGAAA <---------------primer name: STF L
 ****length: 25     Tm = 60.3 C     GC = 48.0
-****antisense primer: AAATCTGGATCATTCCCGAGCGCTG
+****antisense primer: AAATCTGGATCATTCCCGAGCGCTG <-----------primer name: STF R
 ****length: 25     Tm = 64.9 C     GC = 52.0
 ***Primer Set 2:
@@ Line 16: / Line 16: @@
 ****Tm = 70.7 C   TaOpt: 51.4 C    GC: 31.7
 ****area of interest = 23539
-****sense primer: ATCACATCGTCACCCATTGGATTGT
+****sense primer: ATCACATCGTCACCCATTGGATTGT <---------------primer name: ATTP L
 ****length: 25    Tm = 60.1 C    GC = 44.0
-****antisense primer: CGATTTAGAAATGTATAGCGAGGCA
+****antisense primer: CGATTTAGAAATGTATAGCGAGGCA <-----------primer name: ATTP R
 ****length: 25    Tm = 55.9 C    GC = 40.0
+*Taylor Stevenson
+**XL1-Blue MR cells were prepared for phage infection as specified in packaging manual [https://static.igem.org/mediawiki/2008/6/6a/Packaging_Extract.pdf] and infected with phage at roughly a 1/10 pfu/cfu ratio.  Resulting phage/bacteria mixture was incubated @ 37*C for 20 min and then streaked onto an LB plate.  Plate was incubated @ 30*C O/N.
+**'''Result'''-approximately 100 possibly lysogenic colonies grew on plate.
+<BR><BR><BR><BR>
+{| style="color:#1b2c8a;background-color:#0c6;" cellpadding="3" cellspacing="1" border="1" bordercolor="#fff" width="62%" align="center"
+!align="center"|[[Team:Rice_University|Home]]
+!align="center"|[[Team:Rice_University/Team|The Team]]
+!align="center"|[[Team:Rice_University/Project|The Project]]
+!align="center"|[[Team:Rice_University/Parts|Parts Submitted to the Registry]]
+!align="center"|[[Team:Rice_University/Modeling|Modeling]]
+!align="center"|[[Team:Rice_University/Notebook|Notebook]]
+|}

Team:Rice University/Notebook/9 June 2008

From 2008.igem.org

Latest revision as of 20:42, 16 July 2008

Monday 9 June