Team:Illinois/Antibody GPCR Fusion Notebook
From 2008.igem.org
(Difference between revisions)
(→24th September) |
(→Primers) |
||
(72 intermediate revisions not shown) | |||
Line 25: | Line 25: | ||
** 200uL 0.5M EDTA (1mM) | ** 200uL 0.5M EDTA (1mM) | ||
+ | |||
+ | ==Primers== | ||
+ | |||
+ | PGK promoter | ||
+ | Fwd:5'TTTT GAATTC AAAGATGCCGATTTGGGCGC | ||
+ | Rev:5'TTTT GAGCTC GTTTTATATTTGTTGTAAAA | ||
+ | |||
+ | PGK terminator | ||
+ | Fwd:5'TTAT GGGCCC GAAATAAATTGAATTGAATT | ||
+ | Rev:5'TTTTG AAGCTT CAGCTTTAACGAACGCAGA | ||
+ | |||
+ | Ste2 | ||
+ | Fwd:5'GCCC TCTAGA ATGTCTGATGCGGCTCCTTC | ||
+ | Rev:5'TTAT GGGCCC TCATAAATTATTATTATCTT | ||
+ | |||
+ | Fus1 upstream | ||
+ | Fwd:5'GTGG GAATTC TAATAATCAGAACTCCAACA | ||
+ | Rev:5'GGCG TCTAGA TTTGATTTTCAGAAACTTGA | ||
+ | |||
+ | Fus1 downstream: | ||
+ | Fwd:5'GCGA GGTACC TGAAAATAATATTGACGTTC | ||
+ | Rev:5'TTAT GCGGCCGC TATTCACCAGACCCGCTCCT | ||
== 22nd July == | == 22nd July == | ||
Line 105: | Line 127: | ||
* Ran gel of PCR products (1.5% agarose, 200V) | * Ran gel of PCR products (1.5% agarose, 200V) | ||
** Result: No bands present | ** Result: No bands present | ||
+ | [[Image:GPCR8-28.jpg|190px]] | ||
== 2nd September == | == 2nd September == | ||
Line 111: | Line 134: | ||
{| class="wikitable" border="1" | {| class="wikitable" border="1" | ||
|- | |- | ||
- | |Mastermix | + | |5 PRIME Mastermix |
|10uL | |10uL | ||
|x3 | |x3 | ||
Line 148: | Line 171: | ||
*** Too low | *** Too low | ||
** 50 minutes | ** 50 minutes | ||
- | *Poor results | + | *Poor results--no bands present |
== 8th September == | == 8th September == | ||
Line 155: | Line 178: | ||
{| class="wikitable" border="1" | {| class="wikitable" border="1" | ||
|- | |- | ||
- | |Mastermix | + | |5PRIME Mastermix |
|10uL | |10uL | ||
|x3 | |x3 | ||
Line 182: | Line 205: | ||
* Signs of life in 3 of the cultures | * Signs of life in 3 of the cultures | ||
** Wait until tomorrow | ** Wait until tomorrow | ||
- | * Ran gel on PCR from 8th September | + | * Ran gel on PCR from 8th September--no bands present |
** 150V, 50 minutes | ** 150V, 50 minutes | ||
** No sign of DNA | ** No sign of DNA | ||
* Ladder from Courtney | * Ladder from Courtney | ||
- | |||
== 10th September == | == 10th September == | ||
* Split culture | * Split culture | ||
- | * Ran gel from 8th September again | + | * Ran gel from 8th September again--no bands present |
** 150V, 50 minutes | ** 150V, 50 minutes | ||
** 0.75% gel | ** 0.75% gel | ||
Line 200: | Line 222: | ||
{| class="wikitable" border="1" | {| class="wikitable" border="1" | ||
|- | |- | ||
- | |Mastermix | + | |5 PRIME Mastermix |
|10uL | |10uL | ||
|x3 | |x3 | ||
Line 261: | Line 283: | ||
|3uL | |3uL | ||
|- | |- | ||
- | |Template | + | |Template 1 |
|10uL | |10uL | ||
|x3 | |x3 | ||
Line 315: | Line 337: | ||
|MasterAmp Taq 10x PCR Buffer | |MasterAmp Taq 10x PCR Buffer | ||
|5uL | |5uL | ||
- | |||
- | |||
|- | |- | ||
|1mM dNTPs | |1mM dNTPs | ||
|1uL | |1uL | ||
- | |||
- | |||
|- | |- | ||
|Primer 1 | |Primer 1 | ||
- | | | + | |0.5uL |
- | + | ||
- | + | ||
|- | |- | ||
|Primer 2 | |Primer 2 | ||
- | | | + | |0.5uL |
- | + | ||
- | + | ||
|- | |- | ||
|25mM MgCl2 | |25mM MgCl2 | ||
- | | | + | |2uL |
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
- | + | ||
|- | |- | ||
|Taq DNA Polymerase | |Taq DNA Polymerase | ||
|0.25uL | |0.25uL | ||
- | |||
- | |||
|- | |- | ||
- | | | + | |Template 2 |
|20uL | |20uL | ||
- | | | + | |- |
- | | | + | |Water |
+ | |20.75uL | ||
|} | |} | ||
Line 357: | Line 363: | ||
** 4mins, 94 degree celcius | ** 4mins, 94 degree celcius | ||
** 30s, 94 degree celcius | ** 30s, 94 degree celcius | ||
- | ** 30s, | + | ** 30s, 5 degrees below primer melting temperature |
** 1 min, 72 degree celcius -- to step 2 -- 30x | ** 1 min, 72 degree celcius -- to step 2 -- 30x | ||
** 7 min, 72 degree celcius | ** 7 min, 72 degree celcius | ||
Line 367: | Line 373: | ||
== 25th September == | == 25th September == | ||
* PCR: Fus1 Upstream | * PCR: Fus1 Upstream | ||
- | |||
- | |||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |Mastermix | ||
+ | |8.25uL | ||
+ | |x3 | ||
+ | |24.75uL | ||
+ | |- | ||
+ | |Forward Primer | ||
+ | |0.5uL | ||
+ | |x3 | ||
+ | |1.5uL | ||
+ | |- | ||
+ | |Reverse Primer | ||
+ | |0.5uL | ||
+ | |x3 | ||
+ | |1.5uL | ||
+ | |- | ||
+ | |Template 3 | ||
+ | |20uL | ||
+ | |x3 | ||
+ | |60uL | ||
+ | |- | ||
+ | |Water | ||
+ | |20.75uL | ||
+ | |x3 | ||
+ | |62.25uL | ||
+ | |- | ||
+ | |} | ||
+ | |||
+ | **same protocol as 23rd September | ||
+ | **The master mix contains the buffer, dNTPs, MgCl, and Taq | ||
+ | **Template 3 (3 reactions run) | ||
== 30th September == | == 30th September == | ||
* PCR: Fus1 Upstream | * PCR: Fus1 Upstream | ||
- | *same | + | |
- | *Template 4 and 1a | + | {| class="wikitable" border="1" |
+ | |- | ||
+ | |Mastermix | ||
+ | |8.25uL | ||
+ | |x3 | ||
+ | |24.75uL | ||
+ | |- | ||
+ | |Forward Primer | ||
+ | |0.5uL | ||
+ | |x3 | ||
+ | |1.5uL | ||
+ | |- | ||
+ | |Reverse Primer | ||
+ | |0.5uL | ||
+ | |x3 | ||
+ | |1.5uL | ||
+ | |- | ||
+ | |Template 3 | ||
+ | |20uL | ||
+ | |x3 | ||
+ | |60uL | ||
+ | |- | ||
+ | |Water | ||
+ | |20.75uL | ||
+ | |x3 | ||
+ | |62.25uL | ||
+ | |- | ||
+ | |} | ||
+ | ** same protocol as 23rd September | ||
+ | ** Template 4 and 1a (3 reactions each) | ||
+ | |||
+ | ** Gel: 1% agarose, 150V, 35 minutes -> poor results | ||
+ | ** lanes 2,3 -> faint smear | ||
+ | [[Image:GPCR_FUS1_upstream_9-30.jpg|190px]] | ||
== 1st October == | == 1st October == | ||
* PCR: Ste2 | * PCR: Ste2 | ||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |Mastermix | ||
+ | |8.25uL | ||
+ | |x3 | ||
+ | |24.75uL | ||
+ | |- | ||
+ | |Forward Primer | ||
+ | |0.5uL | ||
+ | |x3 | ||
+ | |1.5uL | ||
+ | |- | ||
+ | |Reverse Primer | ||
+ | |0.5uL | ||
+ | |x3 | ||
+ | |1.5uL | ||
+ | |- | ||
+ | |Template 3 | ||
+ | |20uL | ||
+ | |x3 | ||
+ | |60uL | ||
+ | |- | ||
+ | |Water | ||
+ | |20.75uL | ||
+ | |x3 | ||
+ | |62.25uL | ||
+ | |- | ||
+ | |} | ||
+ | **same protocol as 23rd September | ||
+ | **Templates 2a, 3a, 4a used (3 reactions each) | ||
+ | ==3rd October== | ||
+ | * Ran Ste2 gel from 1st October | ||
+ | [[Image:GPCR10-3.jpg|190px]] | ||
== 8th October == | == 8th October == | ||
* PCR: PGK Terminator | * PCR: PGK Terminator | ||
- | |||
- | |||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |PCR Buffer | ||
+ | |5uL | ||
+ | |- | ||
+ | |10mM dNTPs | ||
+ | |1uL | ||
+ | |- | ||
+ | |Forward Primer | ||
+ | |1uL | ||
+ | |- | ||
+ | |Reverse Primer | ||
+ | |1uL | ||
+ | |- | ||
+ | |MgCl2 | ||
+ | |5uL | ||
+ | |- | ||
+ | |Taq DNA Polymerase | ||
+ | |0.25uL | ||
+ | |- | ||
+ | |Template | ||
+ | |25uL | ||
+ | |- | ||
+ | |Water | ||
+ | |11.75uL | ||
+ | |} | ||
+ | |||
+ | **same protocol as 23rd September | ||
+ | ** Use DNA extracted from gel on 18th September (5 reactions) | ||
+ | * Also extracted DNA from gel from 30th September (Fus1 Upstream) | ||
== 9th October == | == 9th October == | ||
* PCR: Ste2 | * PCR: Ste2 | ||
- | * Template used is product from 1st October | + | **Protocol is the same as 23rd September |
- | + | ** Template used is product from 1st October (9 reactions total) | |
- | + | ||
* PCR: Fus1 Upstream | * PCR: Fus1 Upstream | ||
- | * Template used was extracted from | + | **Protocal matches 23rd September |
- | + | **Template used was DNA extracted from the gel from the 8th October, which came from the PCR run on 30th September (5 reactions total) | |
- | |||
+ | * Ran Ste2 gel from today | ||
+ | [[Image:GPCR10-09Ste2.jpg|190px]] | ||
+ | * Ran PGK terminator gel from yesterday | ||
+ | [[Image:GPCR10-09PGKp.jpg|190px]] | ||
+ | |||
+ | == 12th October == | ||
+ | * PCR: Fus1 (3 reactions each) | ||
+ | **Template is products from 9th October | ||
+ | |||
+ | == 13th October == | ||
+ | * Ran gel of PCR with Fus1 | ||
+ | * Used 25uL or product, 5uL of loading dye | ||
+ | [[Image:GPCR10-13.jpg|190px]] | ||
== 14th October == | == 14th October == | ||
* Fus1 PCR | * Fus1 PCR | ||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterAmp Taq 10x PCR Buffer | ||
+ | |5uL | ||
+ | |- | ||
+ | |1mM dNTPs | ||
+ | |1uL | ||
+ | |- | ||
+ | |Primer 1 | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer 2 | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |25mM MgCl2 | ||
+ | |5uL | ||
+ | |- | ||
+ | |Taq DNA Polymerase | ||
+ | |0.25uL | ||
+ | |- | ||
+ | |Template | ||
+ | |25uL | ||
+ | |- | ||
+ | |Water | ||
+ | |11.75uL | ||
+ | |} | ||
* Template is reaction from 12th October | * Template is reaction from 12th October | ||
== 15th October == | == 15th October == | ||
- | * | + | *PCR PGK Terminator |
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |5 PRIME MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |25uL | ||
+ | |- | ||
+ | |Water | ||
+ | |4uL | ||
+ | |} | ||
+ | *Ran gel of Ste2 from 10/14 | ||
+ | [[Image:GPCR10-15Ste2.jpg|190px]] | ||
+ | *Ran gel of Fus1 upstream from 10/14 (no ladder, oops) | ||
+ | [[Image:GPCR10-15.jpg|190px]] | ||
+ | |||
+ | == 16th October == | ||
+ | * PCR: Fus1 Downstream, PGK Promoter | ||
+ | |||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |20uL | ||
+ | |- | ||
+ | |Water | ||
+ | |9uL | ||
+ | |} | ||
+ | |||
+ | ** Tube 1: Template 4 - Fus1 | ||
+ | ** Tube 2: Template 4a - Fus1 | ||
+ | ** Tube 3: Template 4 - PGK Promoter | ||
+ | ** Tube 4: Template 4a - PGK Promoter | ||
+ | |||
+ | *ran Gel of above | ||
+ | [[Image:GPCR10-16Fusd.jpg|190px]] | ||
+ | |||
+ | *ran Gel of PGK terminator from 10/15 | ||
+ | [[Image:GPCR10-16.jpg|190px]] | ||
+ | |||
+ | |||
+ | |||
+ | * Extracted Ste2 from 10/15 and re-amplified: | ||
+ | |||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |20uL | ||
+ | |- | ||
+ | |Water | ||
+ | |9uL | ||
+ | |} | ||
+ | |||
+ | == 17th October == | ||
+ | * Ran gel of Ste2 from 10/16 | ||
+ | ** Tube 1 - lane 2,3 | ||
+ | ** Tube 2 - lane 5,6 | ||
+ | [[Image:GPCR10-17.jpg|190px]] | ||
+ | |||
+ | * PCR: Fus1 upstream | ||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |20uL | ||
+ | |- | ||
+ | |Water | ||
+ | |9uL | ||
+ | |} | ||
+ | **template is products from 10/14 | ||
+ | |||
+ | * PCR: PGK Terminator | ||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |20uL | ||
+ | |- | ||
+ | |Water | ||
+ | |9uL | ||
+ | |} | ||
+ | **Template is products from 10/15 | ||
+ | |||
+ | * Extracted Ste2(Gel from today) | ||
+ | |||
+ | == 18th October== | ||
+ | Ran gel of Fus1 upstream and PGK terminator from yesterday | ||
+ | [[Image:GPCR10-18.jpg|190px]] | ||
+ | |||
+ | == 20th October == | ||
+ | * Extracting chromosomal DNA from yeast cells | ||
+ | ** W303A - Yellow | ||
+ | ** YPD DL | ||
+ | ** YHP1 YPD HD - One is orange (YHP1)(Cap was removed in incubator), Other is Yellow | ||
+ | |||
+ | ** Orange - YHP1 YPD HD | ||
+ | ** Green - YHP2 YPD HD | ||
+ | ** Pink - W303A YPA DL | ||
+ | ** Yellow - WD303A YPD DL | ||
+ | |||
+ | == 21st October == | ||
+ | * PCR: Ste2 | ||
+ | |||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |20uL | ||
+ | |- | ||
+ | |Water | ||
+ | |9uL | ||
+ | |} | ||
+ | |||
+ | * 2 tubes | ||
+ | * Block B of black machine | ||
+ | * Annealing temperature: 31 degrees celcius | ||
+ | |||
+ | * Ran gel on Ste2 from today | ||
+ | [[Image:GPCR10-21.jpg|190px]] | ||
+ | |||
+ | == 22nd October == | ||
+ | * New primers for biobricks are here | ||
+ | ** Brought to standard concentration, 30uM | ||
+ | ** Added 33.3uL of water per nmol primer | ||
+ | |||
+ | * PCR: Fus1 and PGK Terminator | ||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.75uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.75uL | ||
+ | |- | ||
+ | |Template | ||
+ | |25uL | ||
+ | |- | ||
+ | |Water | ||
+ | |3.5uL | ||
+ | |} | ||
+ | |||
+ | ** Forward and Reverse primers are new biobrick primers that arrived today | ||
+ | ** Template is PCR product from 17th October | ||
+ | |||
+ | ** A,B,C -> Fus1 Upstream -> 1,2,3 | ||
+ | ** 1,2 -> PGK Terminator -> 4,5 | ||
+ | ** Annealing temperature: 38 degrees celcius | ||
+ | ** In freezer in yellow case | ||
+ | |||
+ | * PCR: Ste2 | ||
+ | |||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |25uL | ||
+ | |- | ||
+ | |Water | ||
+ | |4uL | ||
+ | |} | ||
+ | |||
+ | ** Forward primer, Reverse Primer are new primers that arrived today | ||
+ | ** Template is PCR product from 21st October | ||
+ | ** Two tubes in block B | ||
+ | |||
+ | * The 3 gels in the cold room do not have EtBr | ||
+ | |||
+ | == 23rd October == | ||
+ | * Ran gel of Fus1 Upstream, PGK Terminator, Ste2 from yesterday | ||
+ | ** 1% Agarose | ||
+ | [[Image:GPCR10-23.jpg|190px]] | ||
+ | |||
+ | * PCR: Fus1 Downstream, PGK Promoter | ||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |20uL | ||
+ | |- | ||
+ | |Water | ||
+ | |9uL | ||
+ | |} | ||
+ | |||
+ | ** 4 reactions each of Fus1 Upstream(1,2,3,4) and PGK Promoter(A,B,C,D) | ||
+ | *Gel shows no bands. | ||
+ | |||
+ | |||
+ | * PCR: Fus1 Downstream, Fus1 Upstream, PGK Promoter, PGK Terminator, Ste2 | ||
+ | ** Template genomic DNA from 20th October (x4 different reactions) | ||
+ | ** Used all Template | ||
+ | |||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |20uL | ||
+ | |- | ||
+ | |Water | ||
+ | |9uL | ||
+ | |} | ||
+ | *Gel shows no bands | ||
+ | |||
+ | ==24th October== | ||
+ | *Ran gel of Fus1 upstream(lanes 3,4,5), PGK terminator(lanes6,7), and Ste2(lanes 8,9) from 10/22 | ||
+ | **ladder is lane 2; 1 and 10 are nothing | ||
+ | [[Image:GPCR10-22.jpg|190px]] | ||
+ | |||
+ | *PCR of Fus1 downstream, Fus1 upstream, PGK promoter, PGK terminator, Ste2 | ||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |MasterMix | ||
+ | |20uL | ||
+ | |- | ||
+ | |Primer Fwd | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Primer Rev | ||
+ | |0.5uL | ||
+ | |- | ||
+ | |Template | ||
+ | |29uL | ||
+ | |} | ||
+ | **The templates were the rest of the genomic DNA extracts from 9/12 | ||
+ | **Three reactions of each gene were run | ||
+ | |||
+ | *Gel from above: | ||
+ | [[Image:GPCR10-24.jpg|190px]][[Image:GPCR10-24(cont.).jpg|190px]] | ||
+ | *(on left)Fus1 downstream lanes 2,3,4; Fus1 upstream lanes 5,6,7; PGK promoter lanes 8,9,10; | ||
+ | *(on right)PGK terminator lanes2,3,10; Ste2 lanes 4,5,6; Fus1 downstream lanes 7,8,9; | ||
+ | |||
+ | ==25th October== | ||
+ | *Extracted DNA from the gel from 10/24 | ||
+ | **FUS1 upstream from the higher bands of lanes 3 and 4 | ||
+ | **PGK terminator from the lower bands of lanes 6 and 7 | ||
+ | *DNA ligation | ||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |DNA | ||
+ | |5uL | ||
+ | |- | ||
+ | |buffer | ||
+ | |5uL | ||
+ | |- | ||
+ | |Re1 (Pst1) | ||
+ | |1uL | ||
+ | |- | ||
+ | |Re2 (EcoR1) | ||
+ | |1uL | ||
+ | |- | ||
+ | |Water | ||
+ | |37.5uL | ||
+ | |} | ||
+ | |||
+ | ==26th October== | ||
+ | *Incubate for 20mins at 80 degrees celcius | ||
+ | {| class="wikitable" border="1" | ||
+ | |- | ||
+ | |Ligation Buffer | ||
+ | |4uL | ||
+ | |- | ||
+ | |DNA Ligase | ||
+ | |1uL | ||
+ | |- | ||
+ | |DNA | ||
+ | |3uL | ||
+ | |- | ||
+ | |Plasmid | ||
+ | |9uL | ||
+ | |- | ||
+ | |Water | ||
+ | |3uL | ||
+ | |} | ||
+ | *Let sit for 5 min. | ||
+ | *5uL of above mixture to competent cells | ||
+ | **30 min. on ice | ||
+ | *Heat shock 30s (42 degrees) | ||
+ | *Add SOC Media (200uL) | ||
+ | **Incubate 60 min.(37 degrees) | ||
+ | *Plate 200uL | ||
+ | **Incubate 37 degrees celcius overnight | ||
+ | ==27th October== | ||
+ | The transformation failed; try again with the same protocol: | ||
+ | *Using extracts 3 and 7 (+Ligation buffers, Ligase, Plasmid, and Water) | ||
+ | *Failed again. | ||
<!-- == Insert Date Here == | <!-- == Insert Date Here == |
Latest revision as of 02:55, 30 October 2008
Home | Team | Project | Notebook | Research Articles | Parts | Protocols | Pictures |
Recipes
- Tris-Cl, 1M
- Dissolve 121g Tris base in 800ml H2O
- Adjust to desired pH with concentrated HCl
- Mix and add H2O to 1 liter
- (Approximately, 20ml HCl for pH 7.4 and 42ml for pH 8.0)
- EDTA, 0.5M (pH 8.0)
- Dissolve 186.1g Na2 EDTA-2H2O in 700ml H20
- Adjust pH to 8.0 with 10M NaOH(~50ml)
- Add H2O to 1 liter
- Breaking buffer - 100ml
- 2ml Triton X-100
- 1ml Sodium dodecyl sulfate (SDS)
- 0.5844g NaCl (100mM)
- 1ml 1M Tris-Cl pH 8.0 (10mM)
- 200uL 0.5M EDTA (1mM)
Primers
PGK promoter Fwd:5'TTTT GAATTC AAAGATGCCGATTTGGGCGC Rev:5'TTTT GAGCTC GTTTTATATTTGTTGTAAAA
PGK terminator Fwd:5'TTAT GGGCCC GAAATAAATTGAATTGAATT Rev:5'TTTTG AAGCTT CAGCTTTAACGAACGCAGA
Ste2 Fwd:5'GCCC TCTAGA ATGTCTGATGCGGCTCCTTC Rev:5'TTAT GGGCCC TCATAAATTATTATTATCTT
Fus1 upstream Fwd:5'GTGG GAATTC TAATAATCAGAACTCCAACA Rev:5'GGCG TCTAGA TTTGATTTTCAGAAACTTGA
Fus1 downstream: Fwd:5'GCGA GGTACC TGAAAATAATATTGACGTTC Rev:5'TTAT GCGGCCGC TATTCACCAGACCCGCTCCT
22nd July
- Yeast obtained from Dr. Zhao
- W303a S. Cerevisiae
24th July
- Prepared liquid culture for DNA extraction
- Made 1M Tris. Cl pH 8.0
- Made 4M ammonium acetate
22nd August
- Attempted DNA extraction of W303a genomic DNA
- Protocol from Wiley's Current Protocols in Molecular Biology
- Result: Failed to finish protocol
- Obtained more yeast from Dr. Zhao
- W303a S. cerevisiae
25th August
- Prepared overnight culture for DNA extraction (3:27pm)
26th August
- Attempted DNA extraction
- Prepped overnight culture
27th August
- Performed PCR: PGK Terminator
Buffer G | 12.5uL | x4 | 50uL | |
Forward Primer | 0.5uL | x4 | 2uL | |
Reverse Primer | 0.5uL | x4 | 2uL | |
H2O | 10.8uL | x4 | 43.2uL | |
Taq | 0.2uL | x4 | 0.8uL | |
template | 0.5ul | |||
Negative control | 3 H2O |
- PCR program:
- 4 min 94 degrees
- 25-30x 30s 94 degrees
- 30s Tm primers
- 1 min/KB 72 degrees
- 7 min 72 degrees
- For the gel: 5uL loading dye gel is in cold room
- Prepped 3 overnight cultures
28th August
- Extracted DNA from 4 cultures
- Ran gel of PCR products (1.5% agarose, 200V)
- Result: No bands present
2nd September
- PCR: PGK Terminator
5 PRIME Mastermix | 10uL | x3 | 30uL |
Forward Primer | 0.5uL | x3 | 1.5uL |
Reverse Primer | 0.5uL | x3 | 1.5uL |
Template | 10uL | x3 | 30uL |
H2O | 10.8uL | x4 | 43.2uL |
Negative control | 25uL H2O |
3rd September
- Ran gel
- Ladder lane 7
- Sample 7 spilled
- 1% agarose
- 120V
- Too low
- 50 minutes
- Poor results--no bands present
8th September
- PCR: PGK Terminator
5PRIME Mastermix | 10uL | x3 | 30uL |
Forward Primer | 0.5uL | x3 | 1.5uL |
Reverse Primer | 0.5uL | x3 | 1.5uL |
Template | 14uL | x3 | 42uL |
- Prepped 4 overnight cultures
- Yeast dried out again
9th September
- Signs of life in 3 of the cultures
- Wait until tomorrow
- Ran gel on PCR from 8th September--no bands present
- 150V, 50 minutes
- No sign of DNA
- Ladder from Courtney
10th September
- Split culture
- Ran gel from 8th September again--no bands present
- 150V, 50 minutes
- 0.75% gel
- Ladder from Courtney
11th September
- PCR: PGK Terminator
5 PRIME Mastermix | 10uL | x3 | 30uL |
Forward Primer | 0.5uL | x3 | 1.5uL |
Reverse Primer | 0.5uL | x3 | 1.5uL |
Template | 14uL | x3 | 42uL |
12th September
- Isolated genomic DNA from 8 cultures of W303a yeast cells
- Protocol from Wiley's Current Protocols in Molecular Biology
- Labeled templates 1,2,3,4 and 1a,2a,3a,4a
- Ran gel of PCR from 11th September
- 1% agarose
- 150V
- 38 mins
- Poor results
15th September
- PCR PGK Promotor
- Finnzymes Phusion High Fidelity DNA Polymerase
- F-530, 20V (2V/uL)
- Finnzymes Phusion High Fidelity DNA Polymerase
5x Phusion HF Buffer | 10uL | x3 | 30uL |
10mM dNTPs | 1uL | x3 | 3uL |
Primer A(Forward) | 1uL | x3 | 3uL |
Primer B(Reverse) | 1uL | x3 | 3uL |
Template 1 | 10uL | x3 | 30uL |
Phusions DNA polymerase | 0.5uL | x3 | 1.5uL |
H2O | 26.5uL | x3 | 79.5uL |
18th September
- Ran reaction mentioned on 15th September
- Extracted DNA from gel from 8th September (PGK Terminator)
Tube | Gel(g) |
1 | 0.332 |
2 | 0.278 |
3 | 0.307 |
4 | 0.349 |
5 | 0.385 |
19th September
- Gel of PGK Promotor from 15th September has no DNA present
23rd September
- PCR: Fus1 Downstream
- EPICENTRE Bioetechnologies - MasterAmp(TM) Taq DNA Polymerase
- Per 50uL of reaction,
MasterAmp Taq 10x PCR Buffer | 5uL |
1mM dNTPs | 1uL |
Primer 1 | 0.5uL |
Primer 2 | 0.5uL |
25mM MgCl2 | 2uL |
Taq DNA Polymerase | 0.25uL |
Template 2 | 20uL |
Water | 20.75uL |
- PCR Settings:
- 4mins, 94 degree celcius
- 30s, 94 degree celcius
- 30s, 5 degrees below primer melting temperature
- 1 min, 72 degree celcius -- to step 2 -- 30x
- 7 min, 72 degree celcius
24th September
- Ran gel of Fus1 Downstream from 23rd September
- Result: No DNA present on gel
25th September
- PCR: Fus1 Upstream
Mastermix | 8.25uL | x3 | 24.75uL |
Forward Primer | 0.5uL | x3 | 1.5uL |
Reverse Primer | 0.5uL | x3 | 1.5uL |
Template 3 | 20uL | x3 | 60uL |
Water | 20.75uL | x3 | 62.25uL |
- same protocol as 23rd September
- The master mix contains the buffer, dNTPs, MgCl, and Taq
- Template 3 (3 reactions run)
30th September
- PCR: Fus1 Upstream
Mastermix | 8.25uL | x3 | 24.75uL |
Forward Primer | 0.5uL | x3 | 1.5uL |
Reverse Primer | 0.5uL | x3 | 1.5uL |
Template 3 | 20uL | x3 | 60uL |
Water | 20.75uL | x3 | 62.25uL |
- same protocol as 23rd September
- Template 4 and 1a (3 reactions each)
- Gel: 1% agarose, 150V, 35 minutes -> poor results
- lanes 2,3 -> faint smear
1st October
- PCR: Ste2
Mastermix | 8.25uL | x3 | 24.75uL |
Forward Primer | 0.5uL | x3 | 1.5uL |
Reverse Primer | 0.5uL | x3 | 1.5uL |
Template 3 | 20uL | x3 | 60uL |
Water | 20.75uL | x3 | 62.25uL |
- same protocol as 23rd September
- Templates 2a, 3a, 4a used (3 reactions each)
3rd October
- Ran Ste2 gel from 1st October
8th October
- PCR: PGK Terminator
PCR Buffer | 5uL |
10mM dNTPs | 1uL |
Forward Primer | 1uL |
Reverse Primer | 1uL |
MgCl2 | 5uL |
Taq DNA Polymerase | 0.25uL |
Template | 25uL |
Water | 11.75uL |
- same protocol as 23rd September
- Use DNA extracted from gel on 18th September (5 reactions)
- Also extracted DNA from gel from 30th September (Fus1 Upstream)
9th October
- PCR: Ste2
- Protocol is the same as 23rd September
- Template used is product from 1st October (9 reactions total)
- PCR: Fus1 Upstream
- Protocal matches 23rd September
- Template used was DNA extracted from the gel from the 8th October, which came from the PCR run on 30th September (5 reactions total)
- Ran Ste2 gel from today
- Ran PGK terminator gel from yesterday
12th October
- PCR: Fus1 (3 reactions each)
- Template is products from 9th October
13th October
- Ran gel of PCR with Fus1
- Used 25uL or product, 5uL of loading dye
14th October
- Fus1 PCR
MasterAmp Taq 10x PCR Buffer | 5uL |
1mM dNTPs | 1uL |
Primer 1 | 0.5uL |
Primer 2 | 0.5uL |
25mM MgCl2 | 5uL |
Taq DNA Polymerase | 0.25uL |
Template | 25uL |
Water | 11.75uL |
- Template is reaction from 12th October
15th October
- PCR PGK Terminator
5 PRIME MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 25uL |
Water | 4uL |
- Ran gel of Ste2 from 10/14
- Ran gel of Fus1 upstream from 10/14 (no ladder, oops)
16th October
- PCR: Fus1 Downstream, PGK Promoter
MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 20uL |
Water | 9uL |
- Tube 1: Template 4 - Fus1
- Tube 2: Template 4a - Fus1
- Tube 3: Template 4 - PGK Promoter
- Tube 4: Template 4a - PGK Promoter
- ran Gel of above
- ran Gel of PGK terminator from 10/15
- Extracted Ste2 from 10/15 and re-amplified:
MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 20uL |
Water | 9uL |
17th October
- Ran gel of Ste2 from 10/16
- Tube 1 - lane 2,3
- Tube 2 - lane 5,6
- PCR: Fus1 upstream
MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 20uL |
Water | 9uL |
- template is products from 10/14
- PCR: PGK Terminator
MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 20uL |
Water | 9uL |
- Template is products from 10/15
- Extracted Ste2(Gel from today)
18th October
Ran gel of Fus1 upstream and PGK terminator from yesterday
20th October
- Extracting chromosomal DNA from yeast cells
- W303A - Yellow
- YPD DL
- YHP1 YPD HD - One is orange (YHP1)(Cap was removed in incubator), Other is Yellow
- Orange - YHP1 YPD HD
- Green - YHP2 YPD HD
- Pink - W303A YPA DL
- Yellow - WD303A YPD DL
21st October
- PCR: Ste2
MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 20uL |
Water | 9uL |
- 2 tubes
- Block B of black machine
- Annealing temperature: 31 degrees celcius
- Ran gel on Ste2 from today
22nd October
- New primers for biobricks are here
- Brought to standard concentration, 30uM
- Added 33.3uL of water per nmol primer
- PCR: Fus1 and PGK Terminator
MasterMix | 20uL |
Primer Fwd | 0.75uL |
Primer Rev | 0.75uL |
Template | 25uL |
Water | 3.5uL |
- Forward and Reverse primers are new biobrick primers that arrived today
- Template is PCR product from 17th October
- A,B,C -> Fus1 Upstream -> 1,2,3
- 1,2 -> PGK Terminator -> 4,5
- Annealing temperature: 38 degrees celcius
- In freezer in yellow case
- PCR: Ste2
MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 25uL |
Water | 4uL |
- Forward primer, Reverse Primer are new primers that arrived today
- Template is PCR product from 21st October
- Two tubes in block B
- The 3 gels in the cold room do not have EtBr
23rd October
- Ran gel of Fus1 Upstream, PGK Terminator, Ste2 from yesterday
- 1% Agarose
- PCR: Fus1 Downstream, PGK Promoter
MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 20uL |
Water | 9uL |
- 4 reactions each of Fus1 Upstream(1,2,3,4) and PGK Promoter(A,B,C,D)
- Gel shows no bands.
- PCR: Fus1 Downstream, Fus1 Upstream, PGK Promoter, PGK Terminator, Ste2
- Template genomic DNA from 20th October (x4 different reactions)
- Used all Template
MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 20uL |
Water | 9uL |
- Gel shows no bands
24th October
- Ran gel of Fus1 upstream(lanes 3,4,5), PGK terminator(lanes6,7), and Ste2(lanes 8,9) from 10/22
- ladder is lane 2; 1 and 10 are nothing
- PCR of Fus1 downstream, Fus1 upstream, PGK promoter, PGK terminator, Ste2
MasterMix | 20uL |
Primer Fwd | 0.5uL |
Primer Rev | 0.5uL |
Template | 29uL |
- The templates were the rest of the genomic DNA extracts from 9/12
- Three reactions of each gene were run
- Gel from above:
- (on left)Fus1 downstream lanes 2,3,4; Fus1 upstream lanes 5,6,7; PGK promoter lanes 8,9,10;
- (on right)PGK terminator lanes2,3,10; Ste2 lanes 4,5,6; Fus1 downstream lanes 7,8,9;
25th October
- Extracted DNA from the gel from 10/24
- FUS1 upstream from the higher bands of lanes 3 and 4
- PGK terminator from the lower bands of lanes 6 and 7
- DNA ligation
DNA | 5uL |
buffer | 5uL |
Re1 (Pst1) | 1uL |
Re2 (EcoR1) | 1uL |
Water | 37.5uL |
26th October
- Incubate for 20mins at 80 degrees celcius
Ligation Buffer | 4uL |
DNA Ligase | 1uL |
DNA | 3uL |
Plasmid | 9uL |
Water | 3uL |
- Let sit for 5 min.
- 5uL of above mixture to competent cells
- 30 min. on ice
- Heat shock 30s (42 degrees)
- Add SOC Media (200uL)
- Incubate 60 min.(37 degrees)
- Plate 200uL
- Incubate 37 degrees celcius overnight
27th October
The transformation failed; try again with the same protocol:
- Using extracts 3 and 7 (+Ligation buffers, Ligase, Plasmid, and Water)
- Failed again.
Home | Team | Project | Notebook | Research Articles | Parts | Protocols | Pictures |