Team:Rice University/Notebook/24 June 2008

From 2008.igem.org

(Difference between revisions)
(New page: =Tuesday 24 June= *Selim Sheikh: **Designed set of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-...)
(→Tuesday 24 June)
 
(2 intermediate revisions not shown)
Line 10: Line 10:
****antisense primer: CCTAGGCAGGTCATTGGCAACAGTG <-----------primer name: stfU R
****antisense primer: CCTAGGCAGGTCATTGGCAACAGTG <-----------primer name: stfU R
****length: 25    Tm = 62.5 C    GC = 56.0
****length: 25    Tm = 62.5 C    GC = 56.0
 +
 +
 +
*David Ouyang
 +
**We are currently having some difficulties extracting the DNA from the binder for this year. We have tried multiple transformations with positive controls (the + grew, the biobricks did not). Today we tried a PCR of the extracted DNA against a positive control.
 +
 +
                                        [[Image:0624BioBrickPCR.jpg]]
 +
 +
***S = Positive Control 1: A biobrick part we want to sequence
 +
***+ = Template was a mix of S,1, and 2, to make sure that the dye or anything else from extraction does not inhibit PCR
 +
***1 = Biobrick G2:1006. Lambda promoter + RFP. Expected length: 935
 +
***2 = Biobrick h3:1002. tetR + CFP. Expected length 940
 +
 +
**The PCR was done with MCS primers which might explain the additional length of the product. The DNA extracted from the binder is faint compared to the + and ladder.

Latest revision as of 17:02, 25 June 2008

Tuesday 24 June

  • Selim Sheikh:
    • Designed set of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify the region bounded by the restriction sites M.NgoMIV and AvrII:
        • product of length 4362
        • contains region of the molecule from 20040 to 24401
        • Tm = 78.4 C TaOpt: 58.7 C GC: 45.5
        • sense primer: GCCGGCGATGCCAGTGCATCAGCTGCTCAG <----------primer name: stfU L
        • length: 30 Tm = 78.2 C GC = 66.7
        • antisense primer: CCTAGGCAGGTCATTGGCAACAGTG <-----------primer name: stfU R
        • length: 25 Tm = 62.5 C GC = 56.0


  • David Ouyang
    • We are currently having some difficulties extracting the DNA from the binder for this year. We have tried multiple transformations with positive controls (the + grew, the biobricks did not). Today we tried a PCR of the extracted DNA against a positive control. 
                                       0624BioBrickPCR.jpg
      • S = Positive Control 1: A biobrick part we want to sequence
      • + = Template was a mix of S,1, and 2, to make sure that the dye or anything else from extraction does not inhibit PCR
      • 1 = Biobrick G2:1006. Lambda promoter + RFP. Expected length: 935
      • 2 = Biobrick h3:1002. tetR + CFP. Expected length 940
    • The PCR was done with MCS primers which might explain the additional length of the product. The DNA extracted from the binder is faint compared to the + and ladder.
Retrieved from "http://2008.igem.org/Team:Rice_University/Notebook/24_June_2008"