Team:University of Washington/Protocols

From 2008.igem.org

(Difference between revisions)

Revision as of 20:40, 1 July 2008

Electrocompetent Cells (One Sample)

This is for making one/two aliquots of electrocompetent cells

1. Grow overnight culture of your cells

2. Back-dilute 1:50 into 3 mLs (so 60 uL), put on rotator in 37 degree incubator for 3 hours (put water on ice during this time)

3. Pellet in epi tube, top speed for ~20-30 sec

4. Remove supernatant. Wash cells 3X in cold water 1 mL each.

5. Resuspend in 40 uL cold water, add DNA, electroporate

Lambda Red Recombination

This is for site-directed mutagenesis of chromosomes or large plasmids

1. Amplify antibiotic resistance cassette with primers that are homologous to cassette and your region of interest.

For Kan:
- Primer 1: 5' bp your sequence + GTGTAGGCTGGAGCTGCTTC - 3' (Tm = 64C)
- Primer 2: 5' bp your sequence + CATATGAATATCCTCCTTAG - 3' (Tm = 54C)
For Tet:
By PCR - 95C 1' 1X; 95C 1', 45C 1', 72C 2' 30X; 72C 10' 1X; 4C hold.

2. Run small aliquot on gel to verify.

3. Qiagen PCR purification kit, elute with water.

4. Transform 15 uL into cells that express lambda red machinery

- If these cells have machinery on pKD46 plasmid: Grow O/N culture at 30C, Sub 1:100 in LB Amp100 + 0.2% arabinose, grow at 30C until OD600 is around 0.6 to 0.8 (25mLs). Wash 2X in cold water (25 mLs, spin 7' at 7K RPM), resuspend in water (100 uL) at density high enough for electroporation.

5. Recover with SOC, plate all on selective media.

6. Streak for isolation

7. Confirm by PCR

Mini Preps

Qiagen Kit
1. 250μL P1 resuspend pellet
2. 250μL P2
3. 350μL N3
4. Centrifuge full speed 10 min.
5. Decant supernatant into filter cartridge
6. Spin 1 min.
·empty collection tube
7. Add 750μL PE wash buffer
8. Spin 1 min.
·empty collection tube
9. Dry spin 2 min.
10. Put filter cartridge in clean eppendorf tube
11. Add 50μL EB
·Centrifuge 2 min. @ 9000 rpm

QuikChange Mutagenesis

Reference: [http://www.stratagene.com/manuals/200516.pdf Stratagene QuikChange® XL Site-Directed Mutagenesis Kit Instruction Manual]

Prep:
- Design the sequences
- Design primers(>= 40% GC, boiling point >= 78C, length ~25-45 bp, mutation between 10-15 correct bases of sequence, terminate in G or C)

1. Add followings to the thin-walled tube for thermocycling
- 5 μl 10× reaction buffer
- X μl (10 ng) dsDNA template
- X μl (125 ng) oligonucleotide primer #1
- X μl (125 ng) oligonucleotide primer #2
- 1 μl dNTP mix
- 3 μl DMSO
2. Add ddH2O to a final volume of 50 μl
3. Add 1 μl of PfuTurbo DNA polymerase (2.5 U/μl)
4. Do temperature cycling.

Segment	Cycles	Temperature	Time
1	1	95°C	1 minute
2	18	95°C	50 seconds
		60°C	50 seconds
		68°C	1 minute/kb of plasmid length
3	1	68°C	7 minutes

5. Cool on ice ~2 mins
6. Add 1 μl Dpn1(10 U/μl)
7. Mix solution using a pipet several times, Spin in a Microcentrifuge for 1 min
8. Incubate the reactions at 37°C for 1 hour

Post:
- PRC purification
- Transformation

Sequencing

From medium- or high-copy miniprepped plasmid DNA obtained via Qiagen kit

1. Dilute primer to 1 pmole/uL (=1 umole/mL)

2. Aliquot 8 uL of primer (=8 pmole) per epi tube for each sequencing reaction (1 primer/tube, so if you are doing forward and reverse reaction, two tubes). Make sure that you use the correct primers for your reaction.

3. Add 4 uL Qiagen-miniprepped plasmid DNA

4. Fill out form on UW DNA Sequencing Facility website. Make sure that you are connected to a printer for this. Use budget number: 75-1064, Box number: 355761. If you do not already have an account, you will have to make one. Use your own phone number, and Herbert's info for PI information (Box 355061, William H. Foege Building, Room N210E). Select "Plasmid DNA", give short description to each tube. Write down the number they give you (usually your initials and then some number) on the top of the epindorf tube. At the bottom, select "Rxn and analysis" and "BDSF's Choice", and NO for printing.

5. Print out two copies of the form, one on colored paper (or on white paper that you can then scribble around the edges with a highlighter or a Sharpie). Give the other copy to Ingrid.

6. Submit to sequencing on the 2nd floor of the Hitchcock building. Turn in the colored form where it says "Drop off". Place your samples in the fridge that says "Rxn and analysis", anywhere in a box that says "Template and primer mix".

Team:University_of_Washington/Project

@@ Line 95: / Line 95: @@
 Post:<br>
-- Somehow extract the new DNA...later..<br>
+- PRC purification<br>
-- Do transformation<br>
+- Transformation<br>
 == Sequencing ==