Template:Team:UC Berkeley/Notebook/CC construction
From 2008.igem.org
(Difference between revisions)
Cicikashou (Talk | contribs) (→K112504) |
Cicikashou (Talk | contribs) (→K112506) |
||
Line 91: | Line 91: | ||
Construction of {<barnase!} basic part K112506 | Construction of {<barnase!} basic part K112506 | ||
- | PCR CC007/ | + | PCR CC007/CC009 on barnase gene ( 354 bp, EcoRI/BamHI) |
Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) | ||
Product is pBca1256-K112506 | Product is pBca1256-K112506 | ||
-------------------------------------------- | -------------------------------------------- | ||
cc007 Forward Biobricking of {<barnase!} | cc007 Forward Biobricking of {<barnase!} | ||
- | + | CGATAgaattcATGaGATCTGCACAGG | |
- | + | CC009 Reverse Biobricking of {<barnase!} | |
CCAGTggatcCTTATCTGATTTTTG | CCAGTggatcCTTATCTGATTTTTG | ||
</pre> | </pre> |
Revision as of 18:33, 2 July 2008
Contents |
K112500
Construction of {<HA>} basic part K112501 Wobble PCR of cc001/cc002 ( 50 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112500 -------------------------------------------- cc001 Forward Biobricking of {<HA>} CgATAgaattcATGagatcttacccatacgacgtcccagac cc002 Reverse biobricking of {<HA>} ccagtggatccccagcgtagtctgggacgtcgtatggg
K112501
Construction of {<HA!} basic part K112502 Wobble PCR of cc001/cc003 ( 53 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112501 -------------------------------------------- cc001 Forward Biobricking of {<HA>} CgATAgaattcATGagatcttacccatacgacgtcccagac cc003 Reverse biobricking of {<HA!} ccagtggatccttaccagcgtagtctgggacgtcgtatgggtaag
K112502
Construction of {<myc>} basic part K112503 Wobble PCR of cc004/cc005 ( 51 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112502 -------------------------------------------- cc004 Forward Biobricking of {<myc>} CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG cc005 Reverse Biobricking of {<myc>} ccagtggatccCAGATCCTCTTCTGAGATGAGTTTTTG
K112503
Construction of {<myc!} basic part K112503 Wobble PCR of cc004/cc006 ( 54 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI,2227+ 910,L) Product is pBca1256-K112503 -------------------------------------------- cc004 Forward Biobricking of {<myc>} CgATAgaattcATGagatctGAACAAAAACTCATCTCAGAAGAGG cc006 Reverse Biobricking of {<myc!} ccagtggatccTTACAGATCCTCTTCTGAGATGAGTTTTTGTTC
K112504
Construction of {<barnase>} basic part K112504 PCR CC007/CC008 on barnase gene ( 351 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112504 -------------------------------------------- cc007 Forward Biobricking of {<barnase>} CGATAgaattcATGaGATCTGCACAGG CC008 Reverse Biobricking of {<barnase>} CCAGTggatcCTCTGATTTTTGTAAAGGTC
K112505
Construction of {barnase>} basic part K112505 PCR CC009/CC008 on barnase gene ( 354 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112505 -------------------------------------------- cc009 Forward Biobricking of {barnase>} CGATAgaattcATGagatctATGGCACAGGTTATCAACACGTTTG cc008 Reverse Biobricking of {barnase>} CCAGTggatcCTCTGATTTTTG
K112506
Construction of {<barnase!} basic part K112506 PCR CC007/CC009 on barnase gene ( 354 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2227+ 910,L) Product is pBca1256-K112506 -------------------------------------------- cc007 Forward Biobricking of {<barnase!} CGATAgaattcATGaGATCTGCACAGG CC009 Reverse Biobricking of {<barnase!} CCAGTggatcCTTATCTGATTTTTG
K112507
Construction of {<barnase!} basic part K112506 PCR mea035/mea034 on Bacillus amyloliquefaciens gen. (320 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+910, L) Product is pBca1256-K112507 ---------------------------------------- mea035 Forward Biobricking of {rbs.barstar!} cgataGAATTCatgAGATCTcataagaaaggagccgcacatg mea034 Reverse Biobricking of {rbs.barstar!} cgttaGGATCCttaagaaagtatgatggtgatgtcgc