Team:Harvard/Dailybook/Week0
From 2008.igem.org
(→Transformed S1 via Electroporation) |
|||
Line 41: | Line 41: | ||
=Tuesday: June 17, 2008= | =Tuesday: June 17, 2008= | ||
- | *GFP/OD Measurement ([[ | + | *GFP/OD Measurement ([[Team:Harvard/PrelimTest#OD_and_GFP_expression_in_E._Coli|results]]) |
*Make glycerol stocks | *Make glycerol stocks | ||
*Miniprep vectors ([[IGEM:Harvard/2008/Lab_Notebooks/GenProtocols#QIAprep_Spin_Miniprep_Kit|protocol]]) | *Miniprep vectors ([[IGEM:Harvard/2008/Lab_Notebooks/GenProtocols#QIAprep_Spin_Miniprep_Kit|protocol]]) |
Revision as of 17:32, 28 October 2008
Contents
|
Monday: June 16, 2008
Meeting Notes
Tic-Tac-Toe
Basic Idea
- Use a chemical signal to induce electric output
- Use E. coli as detector, Shewie as indicator
- Use E. coli to produce lactate, needed for e- production in Shewie
Logistics of Game
Person v. Person
- Example game:
- Player 1 adds chemical
- Computer tracks electric output and displays move on screen
- Player 2 adds chemical
- Computer tracks electric output and displays move on screen
- Repeat
- One chemical detection needed
Person v. Computer
- Example game:
- Player 1 adds chemical
- Computer tracks electric output and displays move on screen
- Computer chooses its move and lights up the well that it decides to move to
- Bacteria respond in a certain way
- Repeat
- One chemical detection and one light detection needed
Person v. Bacteria
- Most complex, based off of DNA paper (See [http://www.ncbi.nlm.nih.gov/pubmed/12923549?dopt=Abstract here])
- Applying ideas from DNA paper to bacteria
- Create 8 strains of different antibiotic resistances
- More feasible in E. coli than in Shewie
Lab
- picked colonies
- rehydrated MR-1 shewie strain
Tuesday: June 17, 2008
- GFP/OD Measurement (results)
- Make glycerol stocks
- Miniprep vectors (protocol)
- Make competent Shewie
- Pour Cm plates
- Transform Shewie with pACYC Duet and GFP vectors
Name Registry Name Description Origin Size Marker E1 [http://partsregistry.org/Part:BBa_J23113 J23113] Low promoter GFP tester pMB1 35 Kan E2 [http://partsregistry.org/Part:BBa_J23113 J23150] Medium promoter GFP tester pMB1 35 Kan E3 [http://partsregistry.org/Part:BBa_J23113 J23151] High promoter GFP tester pMB1 35 Kan E4 [http://www.merckbiosciences.co.uk/html/NVG/duettable.html pACYC duet] Low-Medium copy vector p15a 4008 Cm
- For list of all parts, see here.
- Plasmid DNA Concentrations after Miniprep
Name Registry Name Concentration (ng/uL) E1a [http://partsregistry.org/Part:BBa_J23113 J23113] 67.1 E1b [http://partsregistry.org/Part:BBa_J23113 J23113] 76.2 E2a [http://partsregistry.org/Part:BBa_J23113 J23150] 45.4 E2b [http://partsregistry.org/Part:BBa_J23113 J23150] 72.4 E3a [http://partsregistry.org/Part:BBa_J23113 J23151] 41.8 E3b [http://partsregistry.org/Part:BBa_J23113 J23151] 68.5
- For list of all parts, see here.
Wednesday: June 18, 2008
Protocols
- Cloning Strategy
- Punch out from registry
Name Registry Name Description Origin Size Marker E5 [http://partsregistry.org/Part:pSB3K3 pSB3K3] Low-Medium copy vector p15a 2750 Kan E6 [http://partsregistry.org/Part:BBa-E1010 BBa-E1010] RFP only pMB1 681 Kan E7 [http://partsregistry.org/Part:pSB1A2 pSB1A2] GFP only pMB1 2079 Amp E8 [http://partsregistry.org/Part:BBa_J04450 BBa_J04450] RFP with LacI promoter pMB1 1069 Amp E9 [http://partsregistry.org/Part:BBa_J04430 BBa_J04430] GFP with LacI promoter pMB1 1083 Amp E10 [http://partsregistry.org/Part:BBa_I715038 BBa_I715038] T7 Polymerase with LacI promoter pMB1 2878 Amp
- For list of all parts, see here.
- transform into E. coli TOP10 cells
- Make chemically and electrocompetent Shewie MR-1
- Transform electrocompetent Shewie MR-1 and E. coli
- P3, P4, P5, A1 in shewie
- P3, P4, A1 in E. coli (TOP10)
Results
- Results for Tuesday's (6/17) transformations
- Results for Electrocompetent cells (first procedure no sorbitol)
- P4 (pACYC) worked for both Shewie and E. coli; E. coli had a much higher density of colonies
- None of the other plasmids worked for either Shewie or E. coli cells grew (likely due to low concentrations of cells)
- Results for Chemically competent cells (w/ Zymo procedure)
- No Shewie (5) or E. coli (2) cells grew
- Results for Electrocompetent cells (first procedure no sorbitol)
Thursday: June 19, 2008
Results from Electroporated Shewie and E. coli plates
- Shewie
- P3 J23151 (Kan) colonies grew and expressed GFP; colonies may have a pinkish tint; unexpected b/c origin of replication
- P4 pACYC-Duet (Cm) colonies grew
- P5 pSB3K3 (Kan) no growth, possibly due to the very small volume of DNA added
- A1 (Cm) a few colonies grew
- TOP10
- P3 J23151 (Kan) - colonies grew
- P4 pACYC-Duet (Cm) - a little growth
- A1 (Cm) - colonies grew
Results TOP10 transformations w/ registry parts
- P4 lawn
- P5 no growth?
- P6 no growth?
- P7 many small colonies
- P8 many small colonies
- P9 many small colonies
- P10 many small colonies
Transformed Chemically Competent Cells from Wed 6/18
Restreaking electroporated E. coli plates
Some plates were overgrown (lawns/colonies too dense), so they were replated
- P4 pACYC-Duet (Cm) restreaked from lawn onto 1000x dilution chloramphenicol plate)
- P7 pSB1A2 one big and one small colony onto 2 ampicillin plates
- P8 BBa_J04450 one big and one small colony onto 2 ampicillin plates
- P9 BBa_J04430 one big and one small colony onto 2 ampicillin plates
- P10 BBa_I715038 one big and one small colony onto 2 ampicillin plates
Some plates didn't have any visible colonies
S1 & E1 DNA Alignment
Thu Jun 19 15:45:18 2008
E. coli K12-DH108 from 1 to 1542
Alignment to
Shewanella oneidensis MR-1 from 1 to 1529
Matches(|):1384
Mismatches(#):95
Gaps( ):113
Unattempted(.):0
Primers
Sequence | Location | |
To distinguish S1 | ||
Forward | tcttgaacactgggctctca | 831-850 |
Reverse | cttatttgccagcacgtaat | 1111-1130 |
attacgtgctggcaaataag | reverse complement for reverse primer | |
To distinguish E1 | ||
Forward | acagaactttccagagatgg | 999-1018 |
Reverse | agcaagcggacctcataaag | 1271-1290 |
ctttatgaggtccgcttgct | reverse complement for reverse primer | |
Common Primer | ||
Forward | ttgggttaagtcccgcaacg | 1085-1104 |
Reverse | aatcgtggatcagaatgcca | 1341-1360 |
tggcattctgatccacgatt | reverse complement for reverse primer |
1 aaattgaagagtttgatcatggctcagattgaacgctggcggcaggcctaacacatgcaa 60 | |||||||||||||||||||||||||||||||||||||||||||||||||| 1 a---------gtttgatcatggctcagattgaacgctggcggcaggcctaacacatgcaa 51
61 gtcgaacggta--ac-ag-gaagaagcttgct--tc-tttgctgacgagtggcggacggg 113 |||||#|||#| || || | || || | || |##|#||#||||#|||||||||| 52 gtcgagcggcagcacaagtg-ag----tt--tactcatgaggtggcgagcggcggacggg 104
114 tgagtaatgtct-gggaaactgcctga-tggagggggataacta-ctggaaacggta--g 168 |||||||||#|| ||| |#||||| #| |#|||||||||||| | #|||||||| | | 105 tgagtaatgcctaggg-atctgcc-cagtcgagggggataac-agttggaaacg--actg 159
169 ctaataccgcataacgtcgc--a-agaccaaagagggggaccttcgggcctcttgccatc 225 |||||||||||| ||| | | | #|###||||||||||||#|||||||||||#||#||# 160 ctaataccgcat-acg-c-cctacgggggaaagagggggactttcgggcctctcgcgatt 216
226 ggatgtgcccagatgggattagctagtaggtggggtaacggctcacctaggcgacgatcc 285 |||||##||#||#||||||||||||||#||||#|||||#||||||||#|||||||||||| 217 ggatgaacctaggtgggattagctagttggtgaggtaatggctcaccaaggcgacgatcc 276
286 ctagctggtctgagaggatgaccagccacactggaactgagacacggtccagactcctac 345 |||||||#|||||||||||||#||||||||||||#||||||||||||#|||||||||||| 277 ctagctgttctgagaggatgatcagccacactgggactgagacacggcccagactcctac 336
346 gggaggcagcagtggggaatattgcacaatgggcgcaagcctgatgcagccatgccgcgt 405 |||||||||||||||||||||||||||||||||#|#||#||||||||||||||||||||| 337 gggaggcagcagtggggaatattgcacaatgggggaaaccctgatgcagccatgccgcgt 396
406 gtatgaagaaggccttcgggttgtaaagtactttcagcggggagg-aagggagtaaagt- 463 ||#|||||||||||||||||||||||||#||||||||##|||||| |||| || |||| 397 gtgtgaagaaggccttcgggttgtaaagcactttcagtagggaggaaagg--gt-aagtc 453
464 -taatac--ctt-tgctcattgacgttacccgcagaagaagcaccggctaactccgtgcc 519 |||||| ||| | || #||||||||||##|||||||||#|||||||||||||||||| 454 ctaatacgacttat-ct--gtgacgttacctacagaagaaggaccggctaactccgtgcc 510
520 agcagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgca 579 ||||||||||||||||||||||||#|#|||||||||||||||||||||||||||||||## 511 agcagccgcggtaatacggagggtccgagcgttaatcggaattactgggcgtaaagcgtg 570
580 cgcaggcggtttgttaagtc-agatgtgaaatccccgggctcaacctgggaact-gcatc 637 |||||||||||||||||| | ||||||||||#|||#|||||||||||#|||| | |||| 571 cgcaggcggtttgttaag-cgagatgtgaaagccctgggctcaacctaggaa-tcgcat- 627
638 t--gatactg-gcaagcttgagtctcgtagaggggggtagaattccaggtgtagcggtga 694 | || |||| #||| ||#||||||#|||||||||||||||||||||||||||||||||| 628 ttcga-actgaccaa-ctagagtcttgtagaggggggtagaattccaggtgtagcggtga 685
695 aatgcgtagagatctggaggaataccggtggcgaaggcggccccctggacgaagactgac 754 ||||||||||||||||||||||||||||||||||||||||||||||||||#||||||||| 686 aatgcgtagagatctggaggaataccggtggcgaaggcggccccctggacaaagactgac 745
755 gctcaggtg--cgaaagcgtggggagcaaacaggattagataccctggtagtccacgccg 812 ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| 746 gctca--tgcacgaaagcgtggggagcaaacaggattagataccctggtagtccacgccg 803
813 taaacgatgtcgacttggaggtt--gtgcccttgaggc-gt-ggct-tccggagctaacg 867 |||||||||||#|||#||| ||| ||| #||||| #| #| |||| || #|||||||| 804 taaacgatgtctactcgga-gtttggtg-tcttga-acactgggctctc--aagctaacg 858
868 cgttaagtcgaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacggg 927 |#||||||#||||||||||||||||||||||||||||||||||||||||||||||||||| 859 cattaagtagaccgcctggggagtacggccgcaaggttaaaactcaaatgaattgacggg 918
928 ggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttacctg 987 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||# 919 ggcccgcacaagcggtggagcatgtggtttaattcgatgcaacgcgaagaaccttaccta 978
988 gtcttgacatccacaga--actttccagagatg-gattggtgccttcgggaactgtgaga 1044 #|||||||||||||#|| || |#|||||||| |#|| ||||||||||||||#|||||| 979 ctcttgacatccacggaagac--tgcagagatgcggtt-gtgccttcgggaaccgtgaga 1035
1045 caggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacg 1104 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1036 caggtgctgcatggctgtcgtcagctcgtgttgtgaaatgttgggttaagtcccgcaacg 1095
1105 agcgcaacccttat-ctt-ttgttgccagc-ggt-ccggccgggaactcaaaggagactg 1160 ||||||||||#||| ||| | |||||||| #|| ##|| #||||||||#|#|||||||| 1096 agcgcaacccctatccttat--ttgccagcacgtaatgg-tgggaactctagggagactg 1152
1161 ccagtgataaactggaggaaggtggggatgacgtcaagtcatcatggcccttacgaccag 1220 ||#|||||||||#|||||||||||||||#|||||||||||||||||||||||||||##|| 1153 ccggtgataaaccggaggaaggtggggacgacgtcaagtcatcatggcccttacgagtag 1212
1221 ggctacacacgtgctacaatggcgca-tacaaagag-------aagcgacctcgcgagag 1272 |||||||||||||||||||||||| | ||| |||| |||| |||||| | 1213 ggctacacacgtgctacaatggcg-agtac--agagggttgcaaagc-----cgcgag-g 1263
1273 -caagcggacctcataaag-tgcgtcgtagtccggattggagtctgcaactcgactccat 1330 ##|||##|#||||#|||| | |||||||||||||||||||||||||||||||||||||| 1264 tggagctaatctcacaaagct-cgtcgtagtccggattggagtctgcaactcgactccat 1322
1331 gaagtcggaatcgctagtaatcgtggatcagaatgccacggtgaatacgttcccgggcct 1390 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1323 gaagtcggaatcgctagtaatcgtggatcagaatgccacggtgaatacgttcccgggcct 1382
1391 tgtacacaccgcccgtcacaccatgggagtgggttgcaaaagaagtaggtagcttaacct 1450 |||||||||||||||||||||||||||||||||#||||||||||||#||||||||||||| 1383 tgtacacaccgcccgtcacaccatgggagtgggctgcaaaagaagtgggtagcttaacct 1442
1451 tcgggagggcgcttaccactttgtgattcatgactggggtgaagtcgtaacaaggtaacc 1510 |||||#|||||||#|||||||||||#|||||||||||||||||||||||||||||||#|| 1443 tcgggggggcgctcaccactttgtggttcatgactggggtgaagtcgtaacaaggtagcc 1502
1511 gtaggggaacctgcggttggatcacctcctta 1542 #||||||||||||#||#|||||||||| 1503 ctaggggaacctggggctggatcacct 1529
Transforming TOP 10 with the light sensor biobrick
We attempted to transform TOP 10 E. coli with the light sensor biobrick (to make P11). No colonies were visible the next morning. This is perhaps because the DNA turned pink after being punched out of the notebook.
Friday: June 20, 2008
Results from Thursday 6/19 Transformations
- Shewie - no growth
- E. coli
- P3 lawn
- P4 lawn
- P5 no growth
- P6 no growth
[http://openwetware.org/wiki/IGEM:Harvard/2008/Lab_Notebooks/Meeting_notes#Notes_from_meeting Meeting with Orianna Bretschger]
Transformed S1 via Electroporation
We used the electroporation protocol as noted in General Protocols with the following volumes of vector added:
- P1 (J23113 low) - 2uL
- P2 (J23150 med) - 2uL
- P3 (J23151 high) - 2uL
- P12 (pET Duet-1) - 5uL
- P13 (pCDF Duet) - 1uL
- P14 (pCOLA Duet) - 1uL
Put on the following plates at 30 degrees C over the weekend:
- P1 (J23113 low) - Kan
- P2 (J23150 med) - Kan
- P3 (J23151 high) - Kan
- P12 (pET Duet-1) - Amp
- P13 (pCDF Duet) - Sm
- P14 (pCOLA Duet) - Kan
Transformation of plasmids 11 and 15-20
Chemically competent E. coli DH5a were transformed with plasmids 15-20. Additionally, p11 was repeated.
- We noticed that after punching out the holes from the notebook, the DNA usually turned purple. The DNA that remained yellow turned purple after adding EB buffer. The protocol in the notebook recommends heating the EB buffer before use, but we did not do this. Instead, we incubated the DNA and EB buffer for 20 minutes at 42 °C (instead of at room temperature).
- Additionally, due to time constraints, we only incubated the DNA and bacteria in SOC medium for 1 hour.
Widget
Materials purchased
From McMaster-Carr
Qty. | Part |
1 | Titanium Grade 2 Wire .046" Diameter, 1/8-lb Coil, 38' Coil |
1 ft | Polycarbonate Round Tube 3" OD, 2-5/8" ID, Clear |
1 ft | Polycarbonate Square Tube 1" |
1 ft | Polycarbonate Square Tube 2" OD |
1 ft | Polycarbonate Round Tube 2" OD, 1-7/8" ID, Clear |
2 (pack of 10) | Plastic Quick-Turn(Luer Lock) Coupling Nylon, Female X Male Thread, 1/4"-28 Unf Thread |
2 (pack of 10) | Plastic Quick-Turn(Luer Lock) Coupling Nylon, Male X Barb, for 3/16" Tube ID |
1 | Military Grade Pipe Thread Sealant Tape Premium, 43' Length X 1/2" Width, Light Green |
1 | Military Grade Pipe Thread Sealant Tape Premium, 43' Length X 1/4" Width, Light Orange |
From FuelCellStore
Qty. | Part |
1 10x10cm | E-TEK ELAT™ GDE LT120EW: Low Temperature E-TEK ELAT™ GDE microporous layer including Pt electrode on woven web, thin configuration |
Equipment Purchased
From Keithley
Model No. | Description |
2700 | Model 2700 DMM, Data Acquisition, Datalogging System w/ 2 Slots |
7700 | Model 7700 20-Channel, Differential Multiplexer Module w/ Automatic CJC, Screw Terminals, and up to 50MHz Bandwidth (for Models 2700, 2701, and 2750) |