Team:Rice University/Notebook/24 June 2008
From 2008.igem.org
(Difference between revisions)
DavidOuyang (Talk | contribs) (→Tuesday 24 June) |
DavidOuyang (Talk | contribs) (→Tuesday 24 June) |
||
Line 12: | Line 12: | ||
- | We are currently having some difficulties extracting the DNA from the binder for this year. We have tried multiple transformations with positive controls (the + grew, the biobricks did not). Today we tried a PCR of the extracted DNA against a positive control. | + | *David Ouyang |
+ | **We are currently having some difficulties extracting the DNA from the binder for this year. We have tried multiple transformations with positive controls (the + grew, the biobricks did not). Today we tried a PCR of the extracted DNA against a positive control. | ||
- | [[Image: | + | [[Image:BioBrickPCR.jpg]] |
+ | |||
+ | ***S = Positive Control 1: A biobrick part we want to sequence | ||
+ | ***+ = Template was a mix of S,1, and 2, to make sure that the dye or anything else from extraction does not inhibit PCR | ||
+ | ***1 = Biobrick G2:1006. Lambda promoter + RFP. Expected length: 935 | ||
+ | ***2 = Biobrick h3:1002. tetR + CFP. Expected length 940 | ||
+ | |||
+ | **The PCR was done with MCS primers which might explain the additional length of the product. The DNA extracted from the binder is faint compared to the + and ladder. |
Revision as of 17:00, 25 June 2008
Tuesday 24 June
- Selim Sheikh:
- Designed set of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify the region bounded by the restriction sites M.NgoMIV and AvrII:
-
- product of length 4362
- contains region of the molecule from 20040 to 24401
- Tm = 78.4 C TaOpt: 58.7 C GC: 45.5
- sense primer: GCCGGCGATGCCAGTGCATCAGCTGCTCAG <----------primer name: stfU L
- length: 30 Tm = 78.2 C GC = 66.7
- antisense primer: CCTAGGCAGGTCATTGGCAACAGTG <-----------primer name: stfU R
- length: 25 Tm = 62.5 C GC = 56.0
-
- Designed set of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify the region bounded by the restriction sites M.NgoMIV and AvrII:
- David Ouyang
- We are currently having some difficulties extracting the DNA from the binder for this year. We have tried multiple transformations with positive controls (the + grew, the biobricks did not). Today we tried a PCR of the extracted DNA against a positive control.
- S = Positive Control 1: A biobrick part we want to sequence
- + = Template was a mix of S,1, and 2, to make sure that the dye or anything else from extraction does not inhibit PCR
- 1 = Biobrick G2:1006. Lambda promoter + RFP. Expected length: 935
- 2 = Biobrick h3:1002. tetR + CFP. Expected length 940
- The PCR was done with MCS primers which might explain the additional length of the product. The DNA extracted from the binder is faint compared to the + and ladder.