"
Minnesota/19 June 2008
From 2008.igem.org
(Difference between revisions)
| Line 1: | Line 1: | ||
{|style="align:left" width="965" | {|style="align:left" width="965" | ||
|- | |- | ||
| - | |'''[[Team:Minnesota/NotebookComparator| Back to Notebook]]''' | + | |'''[[Team:Minnesota/NotebookComparator| Back to Notebook Home]]''' |
|- | |- | ||
|'''[[Minnesota/18 June 2008|Go to Previous Day (June 18)]]'''|| width=158|'''[[Minnesota/20 June 2008|Go to Next Day (June 20)]]''' | |'''[[Minnesota/18 June 2008|Go to Previous Day (June 18)]]'''|| width=158|'''[[Minnesota/20 June 2008|Go to Next Day (June 20)]]''' | ||
Revision as of 15:54, 1 July 2008
| Back to Notebook Home | |
| Go to Previous Day (June 18) | Go to Next Day (June 20) |
June 19th
| 1. PROBLEM: A problem was encountered with transformations. Upon checking our incubated plates this a.m., none of the 14 plates exhibited any growth. We were informed that iGEM had alerted all iGEM teams that multiple iGEM teams had had no success with transformation of the BioBrick DNA when using DH5alphaPro competent cells. Instead, iGEM recommended use TOP10 competent cells, which have shown a higher rate of success. We obtained Top10 competent cells from Invitrogen and began the process of re-doing all transformations by using TOP10 cells. |
| 2. Vector NTI and INVITROGEN: Vector NTI is a computer program used by biologists to create a vector diagram of a specific gene regulatory network. These diagrams provide a schematic representation of a plasmid vector and all relevant DNA sequences and parts contained within them. John Barrett, one of our graduate advisors, introduced us to using this program. We will likely make use of this program when designing our comprehensive device – the comparator, when designing primers, and finally, when designing DNA sequences for synthesis. |
| 3. Primer Design: Primers will be crucial for sequencing and PCR throughout the course of our experimentation this summer. Using Vector NTI, the appropriate primers can be easily designed. Primers should be approximately 20 base pairs in length. Primers less than 20 bp’s have a higher probability of binding to a non-specific DNA sequence elsewhere in the vector. Sequences with lengths greater than 20 bps have a higher likelihood of secondary structure which can interfere with DNA binding and decrease their efficiency. Each primer should have a melting temperature between 50 and 65 degrees Celsius, a high G-C (guanine-cytosine) content, especially on the 3’ end. A higher percentage of GCs allows a more stable bond to be formed between the primer and the target DNA, since the G-C bases form three hydrogen bonds, compared to the two hydrogen bonds of A-T. Similarly, melting point is increased as GC content increases, and a higher melting point indicates greater binding affinity. We will need to design primers for each of the BioBrick components in our device. |
| 4. Vector NTI and Replication Summary: Using Vector NTI we located GC repeats (between 3-5) near the 3’ end of the chosen gene (i.e. GFP, Tet R, etc.) sequences so can locate area on that gene for primer to attach to and replicate. Had DNA sequence info from Biobrick number information, then cut and pasted the DNA sequence (ex. AATTGCGCGC…). We looked for 20 bps w/ GC’s near 3’ end, and checked deltaG or free energy of each chosen sequence/section. We want the delta G to be highly negative, indicating that the annealing of primer to DNA will occur spontaneously and requires no input of external energy. Denaturation of this bonding will require the input of energy, thus decreasing the likelihood of any errors occurring during sequencing or PCR. |
- Designed Primers
| Sequence Name | Forward Primer | Reverse Primer |
|---|---|---|
| p22 cII protein | 5’ – CTATCATAGTAGGCATGAGCC – 3’ | 5’ – TTTCTTGGTTCGACTTCGGG – 3’ |
| lambda cI protein | 5’ – AAGCGGTTAGTATGCAGCCG – 3’ | 5’ – CTTGGAGCCTGTTGGTTCGG – 3’ |
| p22 mnt protein | 5’ – AGAGCAGAGGCAAACGGACGG – 3’ | 5’ – TCGTCGTTTGCAGCGGTGG – 3’ |
| LacI promoter | 5’ – CGTTGGCCGATTCATTAATG – 3’ | 5’ – CCACACAACATACGAGCCGG – 3’ |
| GFP | 5’ – GCCCGAAGGTTATGTACAGG – 3’ | 5’ – GCCATGATGTATACATTGTGTGAG -3’ |
| EYFP, YFP | 5’ – CTTCAAGTCCGCCATGCCCG – 3’ | 5’ – CGTTCTTCTGCTTGTGGCC – 3’ |
| mCherry | 5’ – TTGAAGCTGTCCTTCCCCGAGG – 3’ | 5’ – TTCTGCATTACGGGGCCGTC – 3’ |
| pSB2K3 (p22 mnt promoter) | 5’ – ACCGTCATGTTCCTGTAGGC – 3’ | None |
| pSB1A2 (RBS, lambda cI promoter, TetR promoter, p22 cII promoter) | 5’ – CCATAGTTGCCTGACTCCCCG – 3’ | None |
| pSB1AK3 (Terminator) | 5’ – CAAGTCAGCGTAATGCTCTGCC – 3’ | None |
| 5. Sequencing Protocol: John Barrett demonstrated the sequencing protocol which we will be using in the future. The first step is to determine the DNA concentration through spectrophotometry. Spectophotometry should indicate an absorbance between 0.1 and 1.0. In a 94 or 386 well plate, a total of 40 uL of the sequencing solution should be added – 4 microliters of DNA and 36 microliters of purified water. Spectrophotometry will read for absorbances at wavelengths of 260 (DNA) and 280 (protein). This not only allows you to determine the concentration of DNA in your sample, it also allows you to have a measure of DNA purity. Spectrophotometry results are given as absorbances. The conversion to ng/uL = Abs * 50 * dilutionfactor. Approximately 12 uL of DNA sample should be submitted for sequencing. |
