Team:Hawaii/Biobrick conversions

From 2008.igem.org

(Difference between revisions)
(→PCR mutagenesis of GFP)
(→Extraction of Biobrick MCS)
Line 44: Line 44:
===Extraction of Biobrick MCS===
===Extraction of Biobrick MCS===
 +
* Combined:
 +
:* 0.5 μl BBa_C0012 plasmid
 +
:* 0.5 μl 10mM forward primer
 +
:* 0.5 μl 10mM reverse primer
 +
:* 3.5 μl nanopure water
 +
:* 5 μl ''Taq'' (we used EconoTaq Green Taq)
 +
* Ran for 30 cycles of denaturing, annealing, extension
 +
:* Initial denature @ 94C for 2 min.
 +
:* Denature @ 94C for 30 sec.
 +
:* Anneal @ 55C for 30 sec.
 +
:* Extend @ 72C for 90 sec.
 +
:* Final extension @ 72C for 10 min.
 +
:* Held @ 4C inifinitly.
 +
<div style="text-align: center;"> '''Extraction of Biobricks verification, txn termination, and RE sites from any BioBrick vectors containing VF2 and VR'''<div>
 +
{| border="1" class="wikitable"
 +
! Primer
 +
! Sequence
 +
! Length
 +
! G/C content
 +
! T<sub>m</sub>
 +
! Notes
 +
|-
 +
| HindIII+VF2
 +
| cctAAGCTTtgccacctgacgtctaagaa
 +
| 29 bp (20 bp)
 +
| 48.3% (50.0%)
 +
| 65.9 C (58.6 C)
 +
| Includes RE extension HindIII site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VF2 primer.
 +
|-
 +
| BamHI+VR
 +
| ccaGGATCCattaccgcctttgagtgagc
 +
| 29 bp (20 bp)
 +
| 55.2% (50.0%)
 +
| 67.9 C (58.0 C)
 +
| Includes RE extension BamHI site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VR primer.
 +
|}
 +
===Subcloning of GFP fusion brick and pRL1383a Biobrick vector===
===Subcloning of GFP fusion brick and pRL1383a Biobrick vector===
==Results==
==Results==
==Discussion==
==Discussion==

Revision as of 08:19, 16 July 2008

Contents

Objectives

  • Convert GFP (BBa_E0040) into a fusion brick using site-directed mutagenesis.
  • Convert pRL1383a into a Biobrick vector by replacing its natural MCS with the Biobrick MCS

Protocol

PCR mutagenesis of GFP

  • Combined:
  • 1 μl colony sample (above)
  • 0.5 μl 10mM forward primer
  • 0.5 μl 10mM reverse primer
  • 3 μl nanopure water
  • 5 μl Taq (we used EconoTaq Green Taq)
  • Ran for 30 cycles of denaturing, annealing, extension
  • Initial denature @ 94C for 2 min.
  • Denature @ 94C for 30 sec.
  • Anneal @ 55C for 30 sec.
  • Extend @ 72C for 60 sec.
  • Final extension @ 72C for 10 min.
  • Held @ 4C inifinitly.
GFP fusion brick (site directed mutagenesis)
Primer Sequence Length G/C content Tm Notes
GFP fusion foward GCCGCTTCTAGAcgtaaaggag 22 bp 54.55% 60.2 C PCR out from E0040, starts annealing from partial NotI (5 of 8 nucleotides of) site, continues with XbaI, omits TG of ATG codon for site directed mutagenesis, begins again with GFP codon 2-4 (cgt aaa gga)
GFP fusion reverse cgagtcagtgagcgaggaag 20 bp 60% 59.6 C PCR out from E0040, priming after all end sites (5'taataa t actagt a gcggccg ctgcag gCTTCCTCGCTCACTGACTCG3')

Extraction of Biobrick MCS

  • Combined:
  • 0.5 μl BBa_C0012 plasmid
  • 0.5 μl 10mM forward primer
  • 0.5 μl 10mM reverse primer
  • 3.5 μl nanopure water
  • 5 μl Taq (we used EconoTaq Green Taq)
  • Ran for 30 cycles of denaturing, annealing, extension
  • Initial denature @ 94C for 2 min.
  • Denature @ 94C for 30 sec.
  • Anneal @ 55C for 30 sec.
  • Extend @ 72C for 90 sec.
  • Final extension @ 72C for 10 min.
  • Held @ 4C inifinitly.
Extraction of Biobricks verification, txn termination, and RE sites from any BioBrick vectors containing VF2 and VR
Primer Sequence Length G/C content Tm Notes
HindIII+VF2 cctAAGCTTtgccacctgacgtctaagaa 29 bp (20 bp) 48.3% (50.0%) 65.9 C (58.6 C) Includes RE extension HindIII site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VF2 primer.
BamHI+VR ccaGGATCCattaccgcctttgagtgagc 29 bp (20 bp) 55.2% (50.0%) 67.9 C (58.0 C) Includes RE extension BamHI site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VR primer.

Subcloning of GFP fusion brick and pRL1383a Biobrick vector

Results

==Discussion==
Retrieved from "http://2008.igem.org/Team:Hawaii/Biobrick_conversions"