"
Team:Hawaii/Biobrick conversions
From 2008.igem.org
(Difference between revisions)
(→Subcloning of GFP fusion brick and pRL1383a Biobrick vector) |
(→Restriction digested BBa_C0012 and pRL1383a) |
||
| Line 82: | Line 82: | ||
===Subcloning of GFP fusion brick and pRL1383a Biobrick vector=== | ===Subcloning of GFP fusion brick and pRL1383a Biobrick vector=== | ||
| - | ====Restriction | + | ====Restriction digest==== |
| + | * GFP fusion | ||
| + | * BBa_C0012 | ||
| + | * BBa_B0034 derived MCS | ||
| + | * pRL1383a | ||
| + | |||
====Ligated insert and vector==== | ====Ligated insert and vector==== | ||
====Transformed into DH5α==== | ====Transformed into DH5α==== | ||
Revision as of 08:23, 16 July 2008
Contents |
Objectives
- Convert GFP (BBa_E0040) into a fusion brick using site-directed mutagenesis.
- Convert pRL1383a into a Biobrick vector by replacing its natural MCS with the Biobrick MCS
Protocol
PCR mutagenesis of GFP
- Combined:
- 0.5 μl BBa_E0040 plasmid
- 0.5 μl 10mM forward primer
- 0.5 μl 10mM reverse primer
- 3.5 μl nanopure water
- 5 μl Taq (we used EconoTaq Green Taq)
- Ran for 30 cycles of denaturing, annealing, extension
- Initial denature @ 94C for 2 min.
- Denature @ 94C for 30 sec.
- Anneal @ 55C for 30 sec.
- Extend @ 72C for 60 sec.
- Final extension @ 72C for 10 min.
- Held @ 4C inifinitly.
GFP fusion brick (site directed mutagenesis)
| Primer | Sequence | Length | G/C content | Tm | Notes |
|---|---|---|---|---|---|
| GFP fusion foward | GCCGCTTCTAGAcgtaaaggag | 22 bp | 54.55% | 60.2 C | PCR out from E0040, starts annealing from partial NotI (5 of 8 nucleotides of) site, continues with XbaI, omits TG of ATG codon for site directed mutagenesis, begins again with GFP codon 2-4 (cgt aaa gga) |
| GFP fusion reverse | cgagtcagtgagcgaggaag | 20 bp | 60% | 59.6 C | PCR out from E0040, priming after all end sites (5'taataa t actagt a gcggccg ctgcag gCTTCCTCGCTCACTGACTCG3') |
Extraction of Biobrick MCS
- Combined:
- 0.5 μl BBa_C0012 plasmid
- 0.5 μl 10mM forward primer
- 0.5 μl 10mM reverse primer
- 3.5 μl nanopure water
- 5 μl Taq (we used EconoTaq Green Taq)
- Ran for 30 cycles of denaturing, annealing, extension
- Initial denature @ 94C for 2 min.
- Denature @ 94C for 30 sec.
- Anneal @ 55C for 30 sec.
- Extend @ 72C for 90 sec.
- Final extension @ 72C for 10 min.
- Held @ 4C inifinitly.
Extraction of Biobricks verification, txn termination, and RE sites from any BioBrick vectors containing VF2 and VR
| Primer | Sequence | Length | G/C content | Tm | Notes |
|---|---|---|---|---|---|
| HindIII+VF2 | cctAAGCTTtgccacctgacgtctaagaa | 29 bp (20 bp) | 48.3% (50.0%) | 65.9 C (58.6 C) | Includes RE extension HindIII site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VF2 primer. |
| BamHI+VR | ccaGGATCCattaccgcctttgagtgagc | 29 bp (20 bp) | 55.2% (50.0%) | 67.9 C (58.0 C) | Includes RE extension BamHI site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VR primer. |
Subcloning of GFP fusion brick and pRL1383a Biobrick vector
Restriction digest
- GFP fusion
- BBa_C0012
- BBa_B0034 derived MCS
- pRL1383a
