EPF-Lausanne/4 August 2008
From 2008.igem.org
(→PCR) |
(→PCR) |
||
Line 30: | Line 30: | ||
We have checked the sequence of the Lac promoter used by Ron Weiss in his PHD1 plasmid by blasting the promoter part from iGEM sequence ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 Part R0010]) versus the complete plasmid sequence ([http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=59800245 Expression vector pHTSUB-105]). The high similarity gives us good confidence that the iGEM part would work as well. | We have checked the sequence of the Lac promoter used by Ron Weiss in his PHD1 plasmid by blasting the promoter part from iGEM sequence ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 Part R0010]) versus the complete plasmid sequence ([http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=59800245 Expression vector pHTSUB-105]). The high similarity gives us good confidence that the iGEM part would work as well. | ||
+ | <nowiki> | ||
Score = 291 bits (151), Expect = 1e-75 | Score = 291 bits (151), Expect = 1e-75 | ||
Identities = 155/157 (98%), Gaps = 0/157 (0%) | Identities = 155/157 (98%), Gaps = 0/157 (0%) | ||
Line 49: | Line 50: | ||
CPU time: 0.05 user secs. 0.03 sys. secs 0.08 total secs. | CPU time: 0.05 user secs. 0.03 sys. secs 0.08 total secs. | ||
+ | </nowiki> |
Revision as of 13:03, 4 August 2008
Cell culture and miniprep
The DNA which was obtained on 01/08 by miniprep was put on a gel. The gel was clean and correct for the DNA with AmpR, but somehow unneat for the KanR/AmpRKanR ones. One which had been in very high concentration (300 ng/uL) seemed overloaded. The others seemed to contain genomic DNA, which could come from contamination or could be due to the use of spin columns from a different miniprep kit. We will in any case grow them out again with different Kan stock and proceed tomorrow with a digestion reaction, of shorter than overnight, to check the authenticity of the parts.
PCR
A PCR with the following primer-DNA sets was done :
Primer | Biobrick |
RhlR |
DNA | RhlR (I0466) |
RFP (E1010) |
The negative control (RFP with RhlR primer) did not work. The two first positives with Biobrick primers worked. However, the positive with RhlR primers failed. But this RhlR sequence was reported to be inconsistent, which could account for our trouble. We now proceed with the PCR up from the punched-out DNA.
PCR
We have checked the sequence of the Lac promoter used by Ron Weiss in his PHD1 plasmid by blasting the promoter part from iGEM sequence ([http://partsregistry.org/wiki/index.php?title=Part:BBa_R0010 Part R0010]) versus the complete plasmid sequence ([http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=59800245 Expression vector pHTSUB-105]). The high similarity gives us good confidence that the iGEM part would work as well.
Score = 291 bits (151), Expect = 1e-75 Identities = 155/157 (98%), Gaps = 0/157 (0%) Strand=Plus/Plus Query 44 ATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAA 103 ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2317 ATGAAGCTAGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAA 2376 Query 104 TGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTAT 163 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2377 TGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTAT 2436 Query 164 GTTGTGTGGAATTGTGAGCGGATAACAATTTCACACA 200 ||||||||||||||||||||||||||||||||||||| Sbjct 2437 GTTGTGTGGAATTGTGAGCGGATAACAATTTCACACA 2473 CPU time: 0.05 user secs. 0.03 sys. secs 0.08 total secs.