"
EPF-Lausanne/5 September 2008
From 2008.igem.org
(Difference between revisions)
Serge (Talk | contribs)
(New page: [https://2008.igem.org/wiki/index.php?title=EPF-Lausanne/4_September_2008 <<Previous] - [https://2008.igem.org/Team:EPF-Lausanne/Notebook Back to Notebook] - [https://2008.igem.org/wiki/inde...)
Newer edit →
(New page: [https://2008.igem.org/wiki/index.php?title=EPF-Lausanne/4_September_2008 <<Previous] - [https://2008.igem.org/Team:EPF-Lausanne/Notebook Back to Notebook] - [https://2008.igem.org/wiki/inde...)
Newer edit →
Revision as of 08:36, 10 September 2008
<<Previous - Back to Notebook - Next>>
Sequencing
We want to sequence AB and CD. We designed the following primers:
tcacgaggcagaatttcaga, pSB1A2FW aaccgtattaccgcctttga, pSB1A2RV gcgaccagcagaacatctc, AB1seqFW ccagactctaagcggctcac, AB2seqFW caattagcctttttatgccaaca, CD1FW
The first two primers are on the plasmid pSB1A2 and can thus be reused as primers for all parts in the same plasmid. The 3 others are specific to AB resp. CD. The primers have been ordered today.
