"
Team:Rice University/Notebook/24 June 2008
From 2008.igem.org
(Difference between revisions)
Sws2 (Talk | contribs)
(New page: =Tuesday 24 June= *Selim Sheikh: **Designed set of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-...)
Newer edit →
(New page: =Tuesday 24 June= *Selim Sheikh: **Designed set of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-...)
Newer edit →
Revision as of 14:16, 25 June 2008
Tuesday 24 June
- Selim Sheikh:
- Designed set of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify the region bounded by the restriction sites M.NgoMIV and AvrII:
-
- product of length 4362
- contains region of the molecule from 20040 to 24401
- Tm = 78.4 C TaOpt: 58.7 C GC: 45.5
- sense primer: GCCGGCGATGCCAGTGCATCAGCTGCTCAG <----------primer name: stfU L
- length: 30 Tm = 78.2 C GC = 66.7
- antisense primer: CCTAGGCAGGTCATTGGCAACAGTG <-----------primer name: stfU R
- length: 25 Tm = 62.5 C GC = 56.0
-
- Designed set of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify the region bounded by the restriction sites M.NgoMIV and AvrII:
