WetLab work

From 2008.igem.org

(Difference between revisions)
(CdLocalizer)
(CdLocalizer)
Line 12: Line 12:
== '''CdLocalizer''' ==
== '''CdLocalizer''' ==
-
1. Reconstruct pUC18 plasmid, insert GFP to the downstream of lac promoter
+
'''1. Reconstruct pUC18 plasmid, insert GFP to the downstream of lac promoter'''
   
   
1.1 Use touchdown PCR to amplify GFP and add degradation tag and terminator.  
1.1 Use touchdown PCR to amplify GFP and add degradation tag and terminator.  
Line 38: Line 38:
1.9 We sequenced the inserted part and it was right.
1.9 We sequenced the inserted part and it was right.
-
2. Synthesize the Nde I-Pm(complementary chain)-Pst I-Xba I-cad-Spe I-RBS(strong)-CI+LVA tag-Sac II-T1, T2-BamH I (the Blue part is the synthesis sequence) sequence. We use synthesis because we cannot use PCR to get the sequence from Staphyloccocus aureus Rosenbach
+
'''2. Synthesize the Nde I-Pm(complementary chain)-Pst I-Xba I-cad-Spe I-RBS(strong)-CI+LVA tag-Sac II-T1, T2-BamH I (the Blue part is the synthesis sequence) sequence. We use synthesis because we cannot use PCR to get the sequence from Staphyloccocus aureus Rosenbach'''
-
3. Insert CheZ(with tag and terminator) into the reconstruct pUC18(with GFP)
+
'''3. Insert CheZ(with tag and terminator) into the reconstruct pUC18(with GFP)'''
3.1 Extract the genome of E.coli DH5αstrain and use PCR amplify CheZ from it.
3.1 Extract the genome of E.coli DH5αstrain and use PCR amplify CheZ from it.
Line 99: Line 99:
3.13 This sequenced this plasmid and the sequence was right.
3.13 This sequenced this plasmid and the sequence was right.
-
4. Cut the synthesized Nde I-Pm(complementary chain)-Pst I-Xba I-cad-Spe I-RBS(strong)-CI+LVA tag-Sac II-T1, T2-BamH I (the Blue part is the synthesis sequence) sequence with BamH I and Nde I, the same was done on the vector(pUC18-cheZ-tag-ter-GFP). Then ligate them together and got a new reconstruct plasmid. It was also sequenced.
+
'''4. Cut the synthesized Nde I-Pm(complementary chain)-Pst I-Xba I-cad-Spe I-RBS(strong)-CI+LVA tag-Sac II-T1, T2-BamH I (the Blue part is the synthesis sequence) sequence with BamH I and Nde I, the same was done on the vector(pUC18-cheZ-tag-ter-GFP). Then ligate them together and got a new reconstruct plasmid. It was also sequenced.'''
-
5. Put RBS-CI-tag into last vector.
+
'''5. Put RBS-CI-tag into last vector.'''
5.1 Use PCR to amplify CI from lambda DNA, adding RBS to 5’ and tag to 3’
5.1 Use PCR to amplify CI from lambda DNA, adding RBS to 5’ and tag to 3’
Line 130: Line 130:
5.3 Transformation the final plasmid to the ΔCheZ E.coli stain.
5.3 Transformation the final plasmid to the ΔCheZ E.coli stain.
 +
 +
Now we have the reconstructed bacteria!!!
== '''DualReceptor''' ==
== '''DualReceptor''' ==

Revision as of 17:57, 29 October 2008

HOME Team Project 1 Project 2 Parts Modelling Notebook Doodle Board

CdLocalizer

1. Reconstruct pUC18 plasmid, insert GFP to the downstream of lac promoter

1.1 Use touchdown PCR to amplify GFP and add degradation tag and terminator. Primers: Forward: 5’- GA GAATTC G AGCAAGGGCGAGGAGCTGTTCACCG -3’

Reverse: 5’- CTTG CCCGGG TTATCACTTGTACAGCTCGTCCATGC -3’

(Template: provide by Guoqiang Chen’s lab in Tsinghua University)

1.2 Cut pUC18 plasmid with EcoR I and KpnI. Purify the cut pUC18 from agarose gel with Kit.

1.3 Purify the PCR product GFP from agarose gel with Kit and cut with EcoR I and Kpn I.

1.4 Purify the cut GFP with column.

1.5 Run a gel to compare the concentrations of the fragment and vector in order to decide their volume in the ligation mixture.

1.6 Incubate the ligation mixture at 16 degree.

1.7 Use 10μl ligation mixture to transform 200μl DH5αcompetent cell, spread on the LB plate(Amp), and incubate at 37 degree over night.

1.8 Pick three clone to 5ml LB and shake at 37 degree for 12h, miniprep the reconstruct plasmid.

1.9 We sequenced the inserted part and it was right.

2. Synthesize the Nde I-Pm(complementary chain)-Pst I-Xba I-cad-Spe I-RBS(strong)-CI+LVA tag-Sac II-T1, T2-BamH I (the Blue part is the synthesis sequence) sequence. We use synthesis because we cannot use PCR to get the sequence from Staphyloccocus aureus Rosenbach

3. Insert CheZ(with tag and terminator) into the reconstruct pUC18(with GFP)

3.1 Extract the genome of E.coli DH5αstrain and use PCR amplify CheZ from it.

Forward primer:

5’-GTCATGCC CA TATG CAACCATCAATCAAACCTGC-3’

Reverse primer:

5’-AT AGG CCT AAATCCAAGACTATCCAACAAATCGTCCACCTGATC-3’

3.2 Purify the PCR product from gel and then cut with Nde I

3.3 Cut the pAcYc duet-1 plasmid with EcoR V and Nde I

3.4 Run a gel to compare the concentration of the vector and insertion in order to decide the their volumes in the ligation mixture

3.5 Ligate the vector and the cheZ, transformate DH5α and spread the LB plate(Chl).

3.6 Pick three clones to 5ml LB(Chl) and shake at 37 for 12h, then miniprep the reconstruct the plasmid.

3.7 Synthesize the Stu I-tag-Hind III-T0/T1T2-AatII sequence (with stick end), which contains CheZ’s tag and terminator. We firstly synthesized the sequence as two single strings, and then annealing them together as a double string DNA.

The two single strings’ sequence is below: Forward

5’-CCT GCTGCAAACGACGAAAACTACGCTTTAGTAGCT TAA A AGCTT

Stu I end LVA tag stop codon Hind III

CGCAAAAAACCCCGCTTCGGCGGGGTTTTTTCGC GACGT-3’

T0 Aat II end

Reverse

5’- C GCGAAAAAACCCCGCCGAAGCGGGGTTTTTTGCG A AGCTT TTA

Aat II end T0 Hind III stop codon

(complementary)

AGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC AGG

LVA tag (complementary) Stu I end

3.8 Cut the pAcYcduet-1-cheZ plasmid with StuI and Aat II and column purify the vector

3.9 Run a gel to compare the concentration of the vector(pAcYcduet-1-cheZ) and insertion (Stu I-tag-Hind III-T0/T1T2-AatII) to make sure their volumes in the ligation mixture.

3.10 Ligate the two parts transformation spread plate pick 4 clones shake and get the reconstruct plasmid

3.11 We sequenced it and it was right.

3.12 Then we cut the whole CheZ-tag-terminator with NdeI and AatII and ligate the fragment into the pUC18-GFP vector, which is cut by the same two enzymes.

3.13 This sequenced this plasmid and the sequence was right.

4. Cut the synthesized Nde I-Pm(complementary chain)-Pst I-Xba I-cad-Spe I-RBS(strong)-CI+LVA tag-Sac II-T1, T2-BamH I (the Blue part is the synthesis sequence) sequence with BamH I and Nde I, the same was done on the vector(pUC18-cheZ-tag-ter-GFP). Then ligate them together and got a new reconstruct plasmid. It was also sequenced.

5. Put RBS-CI-tag into last vector.

5.1 Use PCR to amplify CI from lambda DNA, adding RBS to 5’ and tag to 3’

First round primers:

5’-GAGGGGACAAactagt ATGAGCACAAAAAAGAAACCATTAACACAAGAGC-3’

5’-TCGTTTGCTGCAGGCCT gccaaacgtctcttcaggccactgac-3’

Second round primers:

5’-C A CTAGT tctagaGAAAGAGGGGACAAactagt ATGAGCACAAAAAAGAAACC-3’

5’-ACT CCGC GG TTA AGCTGCTAAAGCGTAGTTTTCGTCGTTTGCTGCAGGCCT gccaaacgtctcttcagg

We also did a point mutation with PCR to mutate a Hind III restriction cite.

Forwad:

5’-GGCTCCAAGCCTAGCTTTCCTGACGGAATG-3’

Reverve:

5’- cattccgtcaggaaagctaggcttggagcc-3’

5.2 Cut the RBS-CI-tag and the reconstructed vector with Sac II and Spe I and ligate them together.

5.3 Transformation the final plasmid to the ΔCheZ E.coli stain.

Now we have the reconstructed bacteria!!!

DualReceptor

TheoRiboSwitch

HOME Team Project 1 Project 2 Parts Modelling Notebook Doodle Board