Team:Rice University/Notebook/9 June 2008

From 2008.igem.org

Revision as of 19:17, 25 June 2008 by StevensonT (Talk | contribs)

Monday 9 June

  • Selim Sheikh:
    • Designed 2 sets of sequencing primers (using Vector NTI Advance 10 http://www.invitrogen.com/site/us/en/home/LINNEA-Online-Guides/LINNEA-Communities/Vector-NTI-Community/Sequence-analysis-and-data-management-software-for-PCs.html) to be used in PCR of lambda DNA to amplify target regions:
      • Primer Set 1:
        • product of length 538
        • contains region of the molecule from 20481 to 21018
        • Tm = 81.7 C TaOpt: 60.4 C GC: 56.3
        • area of interest = 20833
        • sense primer: GAGACGAATGCCAGGTCATCTGAAA <---------------primer name: STF L
        • length: 25 Tm = 60.3 C GC = 48.0
        • antisense primer: AAATCTGGATCATTCCCGAGCGCTG <-----------primer name: STF R
        • length: 25 Tm = 64.9 C GC = 52.0
      • Primer Set 2:
        • product of length 309
        • contains region of the molecule from 23341 to 23649
        • Tm = 70.7 C TaOpt: 51.4 C GC: 31.7
        • area of interest = 23539
        • sense primer: ATCACATCGTCACCCATTGGATTGT <---------------primer name: ATTP L
        • length: 25 Tm = 60.1 C GC = 44.0
        • antisense primer: CGATTTAGAAATGTATAGCGAGGCA <-----------primer name: ATTP R
        • length: 25 Tm = 55.9 C GC = 40.0
  • Taylor Stevenson
    • Phage infected XL1-blue MR colonies cultured in 96 deep-well plate were spotted onto two EMB plates using a 2uL plate replicator. Both plates were incubated O/N, one at 30*C and one at 42*C (temp is high enough to denature the CI repressor, causing any lysogen to become lytic).
    • Result-both plates showed no bacterial growth after 24h.





Home The Team The Project Parts Submitted to the Registry Modeling Notebook