"
Team:Edinburgh/Results/BABEL
From 2008.igem.org
BABEL: BioBrick Assembly with blunt-ended ligation
BABEL is an alternative, restriction enzyme-free method for generating BioBricks. It is fully compatible with the BioBrick 1.0 standard and also with all of the proposed successor standards, and is itself a potential successor to the BioBrick 1.0 standard in that it can be used for fully scarless assembly. Babel is based on blunt-ended ligation of PCR products followed by fusion PCR and self-ligation. Here we describe the use of BABEL to generate fully compliant BioBricks in pSB1A2, a procedure referred to in our laboratory as 'SOB', or 'Son Of Babel'. Possible extensions of this concept to scarless assembly should be obvious. The 'Son of Babel' procedure is as follows:
- Generate a blunt-ended linear version of pSB1A2 by PCR using appropriate primers which contain the entire BioBrick prefix and suffix. Primers we have used for this are: sobf2 tactagtagcggccgctgcag and sobr1 ctagaagcggccgcgaattc. Since these primers lie entirely within the prefix and suffix regions, they should work for any BioBrick vector. Be sure to use a proof-reading polymerase which will generate a blunt-ended product. We use Kod (Invitrogen), which is as accurate as Pfu and 4 to 5 times faster. Purify your product and store it in the freezer, as it can be used for all of your BABEL cloning experiments.
- Design primers for your insert. These should include only the insert, no non-complementary tails (apart from the extra TAA that may be added to the end of a coding sequence BioBrick), no prefix or suffix. For example, for a coding sequence BioBrick, the forward primer should start with ATG... and the reverse primer with TTATTA.. (giving the double TAATAA stop codon). Since there is no requirement for prefix or suffix sequence, the primers can be shorter and cheaper than those for standard BioBrick cloning.
- Perform PCR to obtain your blunt-ended insert PCR product (again, be sure to use a prrof-reading enzyme which will give a blunt-ended product - not Taq, which usually leaves an A overhang). Check the product on a gel and purify it.
- Ligate your insert PCR product to your linear vector PCR product in a reaction mixture which includes both T4 DNA ligase and T4 Polynucleotide Kinase (PNK). PNK is required to add a 5'-phosphate to the DNA to allow ligation, since standard oligonucleotide primers have a free 5'-hydroxyl group. Fortunately, PNK works well in T4 DNA ligase buffer, which also provides the necessary ATP.
- You can now transform with this primary ligation, but since the linear vector PCR product can self-ligate, most of the colonies will probably just be vector, so unless there is an easy screen or selection for those containing the insert, we recommend doing a second PCR as described below (we did make a vector allowing blue-white selection of insert-containing colonies, but it did not generate a standard BioBrick vector so would not have allowed direct submission of our products to the Registry).
- Perform a secondary PCR reaction using the insert forward primer and vector reverse primer, using a small amount of the primary ligation as a template. This should give you a single PCR product consisting of vector and insert fused together. At this stage, you can also add a ribosome binding site to a coding sequence BioBrick by using a variant reverse primer which contains the ribosome binding site sequence. We used primer sobrbs1, ctagtacctcctctagaagcggccgcaattc, which adds ribosome binding site BBa_K1180012, but found that this was much more likely than the standard reverse primer to generate mutliple PCR products.
