"

 

From 2008.igem.org

Contents 1 Objectives 2 Protocol 2.1 PCR mutagenesis of GFP 2.2 Extraction of Biobrick MCS 2.3 Subcloning of GFP fusion brick and pRL1383a Biobrick vector 3 Results 4 Discussion

Objectives

• Convert GFP (BBa_E0040) into a fusion brick using site-directed mutagenesis.
• Convert pRL1383a into a Biobrick vector by replacing its natural MCS with the Biobrick MCS

Protocol

PCR mutagenesis of GFP

• Combined:

• 1 μl colony sample (above)
• 0.5 μl 10mM forward primer
• 0.5 μl 10mM reverse primer
• 3 μl nanopure water
• 5 μl Taq (we used EconoTaq Green Taq)

• Ran for 30 cycles of denaturing, annealing, extension

• Initial denature @ 94C for 2 min.
• Denature @ 94C for 30 sec.
• Anneal @ 55C for 30 sec.
• Extend @ 72C for 60 sec.
• Final extension @ 72C for 10 min.
• Held @ 4C inifinitly.

Primer	Sequence	Length	G/C content	Tm	Notes
GFP fusion foward	GCCGCTTCTAGAcgtaaaggag	22 bp	54.55%	60.2 C	PCR out from E0040, starts annealing from partial NotI (5 of 8 nucleotides of) site, continues with XbaI, omits TG of ATG codon for site directed mutagenesis, begins again with GFP codon 2-4 (cgt aaa gga)
GFP fusion reverse	cgagtcagtgagcgaggaag	20 bp	60%	59.6 C	PCR out from E0040, priming after all end sites (5'taataa t actagt a gcggccg ctgcag gCTTCCTCGCTCACTGACTCG3')

Extraction of Biobrick MCS

Subcloning of GFP fusion brick and pRL1383a Biobrick vector

Results

Discussion

• Recent changes
• What links here
• Related changes
• Special pages
• My preferences

• Printable version
• Permanent link
• Privacy policy
• Disclaimers