From 2008.igem.org
Objectives
- Convert GFP (BBa_E0040) into a fusion brick using site-directed mutagenesis.
- Convert pRL1383a into a Biobrick vector by replacing its natural MCS with the Biobrick MCS
Protocol
PCR mutagenesis of GFP
- 0.5 μl BBa_E0040 plasmid
- 0.5 μl 10mM forward primer
- 0.5 μl 10mM reverse primer
- 3.5 μl nanopure water
- 5 μl Taq (we used EconoTaq Green Taq)
- Ran for 30 cycles of denaturing, annealing, extension
- Initial denature @ 94C for 2 min.
- Denature @ 94C for 30 sec.
- Anneal @ 55C for 30 sec.
- Extend @ 72C for 60 sec.
- Final extension @ 72C for 10 min.
- Held @ 4C inifinitly.
GFP fusion brick (site directed mutagenesis)
Primer
| Sequence
| Length
| G/C content
| Tm
| Notes
|
GFP fusion foward
| GCCGCTTCTAGAcgtaaaggag
| 22 bp
| 54.55%
| 60.2 C
| PCR out from E0040, starts annealing from partial NotI (5 of 8 nucleotides of) site, continues with XbaI, omits TG of ATG codon for site directed mutagenesis, begins again with GFP codon 2-4 (cgt aaa gga)
|
GFP fusion reverse
| cgagtcagtgagcgaggaag
| 20 bp
| 60%
| 59.6 C
| PCR out from E0040, priming after all end sites (5'taataa t actagt a gcggccg ctgcag gCTTCCTCGCTCACTGACTCG3')
|
- 0.5 μl BBa_B0034 plasmid
- 0.5 μl 10mM forward primer
- 0.5 μl 10mM reverse primer
- 3.5 μl nanopure water
- 5 μl Taq (we used EconoTaq Green Taq)
- Ran for 30 cycles of denaturing, annealing, extension
- Initial denature @ 94C for 2 min.
- Denature @ 94C for 30 sec.
- Anneal @ 55C for 30 sec.
- Extend @ 72C for 90 sec.
- Final extension @ 72C for 10 min.
- Held @ 4C inifinitly.
Extraction of Biobricks verification, txn termination, and RE sites from any BioBrick vectors containing VF2 and VR
Primer
| Sequence
| Length
| G/C content
| Tm
| Notes
|
HindIII+VF2
| cctAAGCTTtgccacctgacgtctaagaa
| 29 bp (20 bp)
| 48.3% (50.0%)
| 65.9 C (58.6 C)
| Includes RE extension HindIII site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VF2 primer.
|
BamHI+VR
| ccaGGATCCattaccgcctttgagtgagc
| 29 bp (20 bp)
| 55.2% (50.0%)
| 67.9 C (58.0 C)
| Includes RE extension BamHI site and three 5' nucleotides for efficient cutting. Parentheses indicate primer information w/o RE site and 3 nucleic acids. Based on VR primer.
|
Subcloning of GFP fusion brick and pRL1383a Biobrick vector
Restriction digest
- GFP fusion
- BBa_C0012
- BBa_B0034 derived MCS
- pRL1383a
Ligated insert and vector
- Ran 20 μl ligation reactions
- 7 μl BioBrick segment (~2.8 ng) + 0.5 μl pRL1383a vector (~0.95 ng)
- 7 μl GFP fusion (~7 ng) + 2 μl C0012 derived vector (~1.8 ng)
Transformed into DH5α
- Used 10 μl of ligation reaction to transform.
- Incubated 10 min. on ice after addition of DNA.
- Plated GFP fusion + vector on LB + amp100
- Plated MCS + pRL1383a on LB + sp100
Results
Discussion