User:Caleb Dulaney/How to make BioBricks

From 2008.igem.org

< User:Caleb Dulaney
Revision as of 14:13, 3 June 2008 by Caleb Dulaney (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

BioBrick Construction

BioBricks are simply genetic "parts". They are made up of a length of DNA capped by a prefix and suffix.

  • Prefix: the prefix is DNA located before the actual gene you're using.
  • If the sequence codes for protein it is: gaattcgcggccgcttctag
  • If not, the sequence is: gaattcgcggccgcttctagag
  • Suffix: the suffix is DNA located after the gene.
  • No matter what type of part you're using, the suffix is: tactagtagcggccgctgcag

These additions to the DNA sequence simply encode for standard restriction enzyme cutting areas and allow the parts to be easily moved around and attached to each other.